Human SNAI1(Snail Homolog 1) ELISA Kit

To Order: Contact us

Human Snail Homolog 1 (SNAI1) ELISA Kit

RD-SNAI1-Hu-48Tests 48 Tests
EUR 521

Human Snail Homolog 1 (SNAI1) ELISA Kit

RD-SNAI1-Hu-96Tests 96 Tests
EUR 723

Human Snail Homolog 1 (SNAI1) ELISA Kit

RDR-SNAI1-Hu-48Tests 48 Tests
EUR 544

Human Snail Homolog 1 (SNAI1) ELISA Kit

RDR-SNAI1-Hu-96Tests 96 Tests
EUR 756

Human Snail Homolog 1 (SNAI1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Snail Homolog 1 (SNAI1) ELISA Kit

SEK089Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Snail Homolog 1 (SNAI1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Snail Homolog 1 (SNAI1) in tissue homogenates, cell lysates and other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit

SEK089Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Snail Homolog 1 (SNAI1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Snail Homolog 1 (SNAI1) in tissue homogenates, cell lysates and other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit

SEK089Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Snail Homolog 1 (SNAI1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Snail Homolog 1 (SNAI1) in tissue homogenates, cell lysates and other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit

SEK089Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Snail Homolog 1 (SNAI1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Snail Homolog 1 (SNAI1) in tissue homogenates, cell lysates and other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Snail Homolog 1 elisa. Alternative names of the recognized antigen: SLUGH2
  • SNA
  • SNAH
  • Snail 1 Zinc Finger Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Snail Homolog 1 (SNAI1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Snail Homolog 1 (SNAI1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Snail Homolog 1 (SNAI1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Antibody

abx331451-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Antibody

abx331682-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Antibody

abx430958-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Snail Homolog 1 (SNAI1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Snail Homolog 1 (SNAI1)

  • EUR 410.02
  • EUR 212.00
  • EUR 1262.56
  • EUR 487.52
  • EUR 875.04
  • EUR 337.00
  • EUR 3006.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95863
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Snail Homolog 1 expressed in: E.coli

Human Snail Homolog 1 (SNAI1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1706.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Snail Homolog 1 (SNAI1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human SNAI1 (Snail Homolog 1)

ELK4384 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Snail Homolog 1 (SNAI1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Snail Homo
  • Show more
Description: A sandwich ELISA kit for detection of Snail Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-Snail homolog 1 / SNAI1 antibody

STJ70994 100 µg
EUR 359

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SNAI1 (Met1~Arg264)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1)

Anti-Snail homolog 1 / SNAI1, Biotinylated antibody

STJ73236 100 µg
EUR 359

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SNAI1 (Met1~Arg264)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with APC.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SNAI1 (Met1~Arg264)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with Biotin.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SNAI1 (Met1~Arg264)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with Cy3.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SNAI1 (Met1~Arg264)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with FITC.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SNAI1 (Met1~Arg264)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with HRP.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SNAI1 (Met1~Arg264)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with PE.

SNAIL (SNAI1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

SNAIL (SNAI1) Antibody

abx031509-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SNAIL (SNAI1) Antibody

abx031509-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SNAIL (SNAI1) Antibody

abx031510-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SNAIL (SNAI1) Antibody

abx031510-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal Snail homolog 1 / SNAI1 Antibody (N-Term)

APG00471G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Snail homolog 1 / SNAI1 (N-Term). This antibody is tested and proven to work in the following applications:

Snail Homolog 1 Phospho-Ser246 (SNAI1 pS246) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SNAI1 (Met1~Arg264)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with APC-Cy7.

Anti-SNAIL/SNAI1 Antibody

PB9399 100ug/vial
EUR 294

Polyclonal SNAI1 / SNAIL-1 Antibody (Internal)

APR03360G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SNAI1 / SNAIL-1 (Internal). This antibody is tested and proven to work in the following applications:

Human Snail Homolog ELISA kit

E01S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Snail Homolog ELISA kit

E01S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Snail Homolog ELISA kit

E01S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

abx122421-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

abx012238-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

abx012239-100ug 100 ug
EUR 425
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

abx031511-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

abx031511-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

abx031512-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

abx031512-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

abx238051-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Snail Homolog ELISA kit

E03S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Snail Homolog ELISA kit

E03S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Snail Homolog ELISA kit

E03S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Snail Homolog ELISA kit

E02S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Snail Homolog ELISA kit

E02S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Snail Homolog ELISA kit

E02S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Snail Homolog ELISA kit

E04S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Snail Homolog ELISA kit

E04S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Snail Homolog ELISA kit

E04S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Snail Homolog ELISA kit

E06S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Snail Homolog ELISA kit

E06S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Snail Homolog ELISA kit

E06S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Snail Homolog ELISA kit

E08S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Snail Homolog ELISA kit

E08S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Snail Homolog ELISA kit

E08S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Snail Homolog ELISA kit

E07S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Snail Homolog ELISA kit

E07S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Snail Homolog ELISA kit

E07S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Snail Homolog ELISA kit

E09S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Snail Homolog ELISA kit

E09S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Snail Homolog ELISA kit

E09S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

SNAI1 Snail Family Zinc Finger 1 Human Recombinant Protein

PROTO95863 Regular: 20ug
EUR 317
Description: SNAI1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 287 amino acids (1-264 a.a) and having a molecular mass of 31.5kDa.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody (Biotin)

abx430959-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human snail homolog 2(SNAI2)ELISA Kit

GA-E1894HM-48T 48T
EUR 289

Human snail homolog 2(SNAI2)ELISA Kit

GA-E1894HM-96T 96T
EUR 466

human snail homolog 2,SNAI2 ELISA Kit

201-12-1878 96 tests
EUR 440
  • This snail homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human snail homolog 2, SNAI2 ELISA Kit

CSB-E11753h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human snail homolog 2, SNAI2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human snail homolog 2, SNAI2 ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human snail homolog 2, SNAI2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human snail homolog 2(SNAI2)ELISA Kit

QY-E01031 96T
EUR 361

Guinea pig Snail Homolog ELISA kit

E05S0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Snail Homolog ELISA kit

E05S0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Snail Homolog ELISA kit

E05S0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Snail Homolog 2 (Drosophila) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.


EF003084 96 Tests
EUR 689

Human Zinc finger protein SNAI1, SNAI1 ELISA KIT

ELI-18182h 96 Tests
EUR 824

ELISA kit for Human Zinc finger protein SNAI1 (SNAI1)

KTE62329-48T 48T
EUR 332
  • SNAI1 is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.A single transc
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Zinc finger protein SNAI1 (SNAI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zinc finger protein SNAI1 (SNAI1)

KTE62329-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SNAI1 is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.A single transc
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Zinc finger protein SNAI1 (SNAI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zinc finger protein SNAI1 (SNAI1)

KTE62329-96T 96T
EUR 539
  • SNAI1 is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.A single transc
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Zinc finger protein SNAI1 (SNAI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SNAI1 ELISA Kit (Human) (OKCD00589)

OKCD00589 96 Wells
EUR 831
Description: Description of target: Involved in induction of the epithelial to mesenchymal transition (EMT), formation and maintenance of embryonic mesoderm, growth arrest, survival and cell migration. Binds to 3 E-boxes of the E-cadherin/CDH1 gene promoter and to the promoters of CLDN7 and KRT8 and, in association with histone demethylase KDM1A which it recruits to the promoters, causes a decrease in dimethylated H3K4 levels and represses transcription. Associates with EGR1 and SP1 to mediate tetradecanoyl phorbol acetate (TPA)-induced up-regulation of CDKN2B, possibly by binding to the CDKN2B promoter region 5'-TCACA-3. In addition, may also activate the CDKN2B promoter by itself.6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.7"The transcription factor Snail is a repressor of E-cadherin gene expression in epithelial tumour cells."_x005F_x005F_x000D_Batlle E., Sancho E., Franci C., Dominguez D., Monfar M., Baulida J., Garcia de Herreros A._x005F_x005F_x000D_Nat. Cell Biol. 2:84-89(2000) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] OF 1-172, FUNCTION, TISSUE SPECIFICITY.Ref.10"A molecular role for lysyl oxidase-like 2 enzyme in snail regulation and tumor progression."_x005F_x005F_x000D_Peinado H., Del Carmen Iglesias-de la Cruz M., Olmeda D., Csiszar K., Fong K.S., Vega S., Nieto M.A., Cano A., Portillo F._x005F_x005F_x000D_EMBO J. 24:3446-3458(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH LOXL2 AND LOXL3, MUTAGENESIS OF LYS-9; LYS-16; LYS-98 AND LYS-137.Ref.12"Wnt-dependent regulation of the E-cadherin repressor snail."_x005F_x005F_x000D_Yook J.I., Li X.Y., Ota I., Fearon E.R., Weiss S.J._x005F_x005F_x000D_J. Biol. Chem. 280:11740-11748(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH GSK3B AND BTRC, PHOSPHORYLATION AT SER-104 AND SER-107, MUTAGENESIS OF SER-96; SER-104 AND SER-107.Ref.16"Snail associates with EGR-1 and SP-1 to upregulate transcriptional activation of p15INK4b."_x005F_x005F_x000D_Hu C.T., Chang T.Y., Cheng C.C., Liu C.S., Wu J.R., Li M.C., Wu W.S._x005F_x005F_x000D_FEBS J. 277:1202-1218(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH EGR1, INDUCTION.Ref.21"Requirement of the histone demethylase LSD1 in Snai1-mediated transcriptional repression during epithelial-mesenchymal transition."_x005F_x005F_x000D_Lin T., Ponn A., Hu X., Law B.K., Lu J._x005F_x005F_x000D_Oncogene 29:4896-4904(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH KDM1A, MUTAGENESIS OF PRO-2.Ref.26"Lats2 kinase potentiates Snail1 activity by promoting nuclear retention upon phosphorylation."_x005F_x005F_x000D_Zhang K., Rodriguez-Aznar E., Yabuta N., Owen R.J., Mingot J.M., Nojima H., Nieto M.A., Longmore G.D._x005F_x005F_x000D_EMBO J. 31:29-43(2012) [PubMed] [Europe PMC] [Abstract]Cited for: IDENTIFICATION BY MASS SPECTROMETRY, FUNCTION, SUBCELLULAR LOCATION, PHOSPHORYLATION AT THR-203 BY LATS2, MUTAGENESIS OF THR-203. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

Mouse Zinc finger protein SNAI1, Snai1 ELISA KIT

ELI-18183m 96 Tests
EUR 865


abx595555-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.


GT15245 100 ug
EUR 526

SNAI1 (pS246) Cell ELISA Kit

abx596033-296tests 2 × 96 tests
EUR 707
  • Shipped within 1-2 weeks.

Snail antibody

38667-100ul 100ul
EUR 252


YF-PA14701 50 ug
EUR 363
Description: Mouse polyclonal to SNAIL


YF-PA14702 50 ug
EUR 363
Description: Mouse polyclonal to SNAIL


YF-PA14703 100 ul
EUR 403
Description: Rabbit polyclonal to SNAIL


YF-PA14704 100 ug
EUR 403
Description: Rabbit polyclonal to SNAIL

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

SNAI1 Colorimetric Cell-Based ELISA Kit

EKC1532 100ul
EUR 572

SNAI1 Antibody

AF6032 200ul
EUR 304
Description: SNAI1 Antibody detects endogenous levels of total SNAI1.

SNAI1 Antibody

BF0595 200ul
EUR 376
Description: SNAI1 antibody detects endogenous levels of total SNAI1.

SNAI1 Antibody

ABF6032 100 ug
EUR 438

SNAI1 antibody

70R-50405 100 ul
EUR 244
Description: Purified Polyclonal SNAI1 antibody

SNAI1 antibody

70R-36806 100 ug
EUR 327
Description: Rabbit Polyclonal SNAI1 antibody

SNAI1 antibody

70R-7981 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SNAI1 antibody

SNAI1 Antibody

35921-100ul 100ul
EUR 252

SNAI1 antibody

10R-10243 50 ul
EUR 219
Description: Mouse monoclonal SNAI1 antibody

SNAI1 antibody

10R-10704 100 ug
EUR 349
Description: Mouse monoclonal SNAI1 antibody

SNAI1 antibody

10R-5840 100 ul
EUR 691
Description: Mouse monoclonal SNAI1 antibody

SNAI1 antibody

10R-5841 100 ul
EUR 726
Description: Mouse monoclonal SNAI1 antibody

SNAI1 Antibody

29041-100ul 100ul
EUR 252

SNAI1 antibody

70R-20415 50 ul
EUR 435
Description: Rabbit polyclonal SNAI1 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SNAI1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

SNAI1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

SNAI1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SNAI1 Antibody

CSB-PA162021-100ul 100ul
EUR 314
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SNAI1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SNAI1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human SNAI1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SNAI1 Recombinant Protein (Human)

RP029464 100 ug Ask for price

Snail Conjugated Antibody

C38667 100ul
EUR 397

Snail Rabbit pAb

A11794-100ul 100 ul
EUR 308

Snail Rabbit pAb

A11794-200ul 200 ul
EUR 459

Snail Rabbit pAb

A11794-20ul 20 ul
EUR 183

Snail Rabbit pAb

A11794-50ul 50 ul
EUR 223

Snail Rabbit pAb

A12301-100ul 100 ul
EUR 308

Snail Rabbit pAb

A12301-200ul 200 ul
EUR 459

Snail Rabbit pAb

A12301-20ul 20 ul
EUR 183

Snail Rabbit pAb

A12301-50ul 50 ul
EUR 223

Snail Rabbit pAb

A5243-100ul 100 ul
EUR 308

Snail Rabbit pAb

A5243-200ul 200 ul
EUR 459

Snail Rabbit pAb

A5243-20ul 20 ul
EUR 183

Snail Rabbit pAb

A5243-50ul 50 ul
EUR 223

Snail Rabbit pAb

A5544-100ul 100 ul
EUR 308

Snail Rabbit pAb

A5544-200ul 200 ul
EUR 459

Snail Rabbit pAb

A5544-20ul 20 ul
EUR 183

Snail Rabbit pAb

A5544-50ul 50 ul
EUR 223

Anti-SNAIL (2G11)

YF-MA15499 100 ug
EUR 363
Description: Mouse monoclonal to SNAIL

Anti-SNAIL (1A5)

YF-MA15500 100 ug
EUR 363
Description: Mouse monoclonal to SNAIL

Human Snail Family Transcriptional Repressor 3 (SNAI3) ELISA Kit

abx383331-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

SNAI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2205202 1.0 ug DNA
EUR 154

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Snail Family Zinc Finger 1 Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Snail Family Zinc Finger 1 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Notch Homolog 1 ELISA kit

E01N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SNAI1 Colorimetric Cell-Based ELISA Kit (OKAG01044)

OKAG01044 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

SNAI1 Blocking Peptide

AF6032-BP 1mg
EUR 195

SNAI1 Blocking Peptide

BF0595-BP 1mg
EUR 195

SNAI1 Conjugated Antibody

C35921 100ul
EUR 397

SNAI1 Conjugated Antibody

C29041 100ul
EUR 397

SNAI1 cloning plasmid

CSB-CL021867HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagcgagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctgctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgct
  • Show more
Description: A cloning plasmid for the SNAI1 gene.

anti- SNAI1 antibody

FNab08051 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:50-1:500
  • Immunogen: snail homolog 1(Drosophila)
  • Uniprot ID: O95863
  • Gene ID: 6615
  • Research Area: Metabolism, Cardiovascular, Developmental biology, Neuroscience, Stem Cells
Description: Antibody raised against SNAI1

SNAI1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

SNAI1 (pS246) Antibody

abx012240-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

SNAI1 (pS246) Antibody

abx332967-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

SNAI1 (pS246) Antibody

abx333357-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

SNAI1 Polyclonal Antibody

A61062 100 µg
EUR 570.55
Description: The best epigenetics products

SNAI1 antibody (Ser246)

70R-36329 100 ug
EUR 327
Description: Rabbit polyclonal SNAI1 antibody (Ser246)

SNAI1 Blocking Peptide

33R-6304 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SNAI1 antibody, catalog no. 70R-7981

Anti-SNAI1 antibody

PAab08051 100 ug
EUR 386

anti-SNAI1 (6D2)

LF-MA30539 100 ul
EUR 527
Description: Mouse Monoclonal to SNAI1

Anti-SNAI1 antibody

STJ29909 100 µl
EUR 277
Description: The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.

Anti-SNAI1 antibody

STJ27533 100 µl
EUR 277
Description: The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.

Anti-SNAI1 antibody

STJ113375 100 µl
EUR 277
Description: The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.

Anti-SNAI1 antibody

STJ114189 100 µl
EUR 277
Description: The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

SNAI1 ORF Vector (Human) (pORF)

ORF009822 1.0 ug DNA
EUR 95

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

pEGFP-N1-Snail Plasmid

PVTB00223-2a 2 ug
EUR 356

SNAI1 (Phospho-Ser246) Colorimetric Cell-Based ELISA Kit

EKC2339 100ul
EUR 572

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Dachshund Homolog 1 (DACH1) ELISA Kit

abx556324-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Roundabout homolog 1 (ROBO1) ELISA Kit

abx556329-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Frizzled Homolog 1 (FZD1) ELISA Kit

abx571378-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Dickkopf 1 Homolog (DKK1) ELISA Kit

abx576304-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human DAB1/ Disabled homolog 1 ELISA Kit

E0654Hu 1 Kit
EUR 605

Human Protein pellino homolog 1 ELISA kit

E01P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit

E01P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit

E01P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Achaete scute homolog 1 ELISA kit

E01A0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Achaete scute homolog 1 ELISA kit

E01A0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit

E01C2038-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit

E01C2038-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit

E01C2038-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Disabled homolog 1

EK3039 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Roundabout homolog 1

EK4583 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Roundabout homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Ovostatin homolog 1

EK5036 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ovostatin homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human OVOS1/ Ovostatin homolog 1 ELISA Kit

E1844Hu 1 Kit
EUR 605

Human ROBO1/ Roundabout homolog 1 ELISA Kit

E2165Hu 1 Kit
EUR 605

Human DAB1(Disabled homolog 1) ELISA Kit

EH1419 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: O75553
  • Alias: DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human OVOS1(Ovostatin homolog 1) ELISA Kit

EH2509 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q6IE37
  • Alias: OVOS1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Nanos homolog 1, NANOS1 ELISA KIT

ELI-20656h 96 Tests
EUR 824

Human Dapper homolog 1, DACT1 ELISA KIT

ELI-26384h 96 Tests
EUR 824

Human Disabled homolog 1, DAB1 ELISA KIT

ELI-04118h 96 Tests
EUR 824

Human Pumilio homolog 1, PUM1 ELISA KIT

ELI-15545h 96 Tests
EUR 824

Human Pygopus homolog 1, PYGO1 ELISA KIT

ELI-16773h 96 Tests
EUR 824

Human Dachshund homolog 1, DACH1 ELISA KIT

ELI-09038h 96 Tests
EUR 824

Human Roundabout homolog 1, ROBO1 ELISA KIT

ELI-53163h 96 Tests
EUR 824

Human Crumbs homolog 1, CRB1 ELISA KIT

ELI-33725h 96 Tests
EUR 824

Human Ovostatin homolog 1, OVOS1 ELISA KIT

ELI-37024h 96 Tests
EUR 824

Human SNAI1(Snail Homolog 1) ELISA Kit