Human RNASE6(Ribonuclease A6) ELISA Kit

To Order: Contact us

Human Ribonuclease A6 (RNASE6) ELISA Kit
RD-RNASE6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Ribonuclease A6 (RNASE6) ELISA Kit
RD-RNASE6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Ribonuclease A6 (RNASE6) ELISA Kit
RDR-RNASE6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Ribonuclease A6 (RNASE6) ELISA Kit
RDR-RNASE6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Ribonuclease A6 (RNASE6) ELISA Kit
20-abx152965	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Ribonuclease A6 ELISA Kit (RNASE6)
RK02202	Abclonal	96 Tests	EUR 521

Human Ribonuclease A6(RNASE6)ELISA Kit
QY-E03170	Qayee Biotechnology	96T	EUR 361

Human Ribonuclease A6 (RNASE6) ELISA Kit
SED192Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
SED192Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
SED192Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
SED192Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit
4-SED192Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Ribonuclease A6 elisa. Alternative names of the recognized antigen: RNS6 Rnase-A6 RNase K6 Ribonuclease, RNase A Family, K6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ribonuclease A6 (RNASE6) Antibody
abx146122-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ribonuclease A6 (RNASE6) Antibody
20-abx101667	Abbexa	EUR 314.00 EUR 133.00 EUR 815.00 EUR 425.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ribonuclease A6 (RNASE6) Antibody
20-abx174411	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Ribonuclease A6 (RNASE6)
4-RPD192Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q93091 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Ribonuclease A6 expressed in: E.coli

Human Ribonuclease A6 (RNASE6) Protein
20-abx068920	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Ribonuclease A6 (RNASE6) CLIA Kit
20-abx494130	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human RNASE6 (Ribonuclease A6)
ELK4520	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribonuclease A6 (RNASE6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ribonucle Show more
Description: A sandwich ELISA kit for detection of Ribonuclease A6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Ribonuclease A6 (RNASE6) Antibody (Biotin)
20-abx272323	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Ribonuclease A6 (RNASE6) Polyclonal Antibody (Human)
4-PAD192Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RNASE6 (Pro25~Leu150) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A6 (RNASE6)

Ribonuclease A6 (RNASE6) Polyclonal Antibody (Human), APC
4-PAD192Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RNASE6 (Pro25~Leu150) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A6 (RNASE6). This antibody is labeled with APC.

Ribonuclease A6 (RNASE6) Polyclonal Antibody (Human), Biotinylated
4-PAD192Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RNASE6 (Pro25~Leu150) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A6 (RNASE6). This antibody is labeled with Biotin.

Ribonuclease A6 (RNASE6) Polyclonal Antibody (Human), Cy3
4-PAD192Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RNASE6 (Pro25~Leu150) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A6 (RNASE6). This antibody is labeled with Cy3.

Ribonuclease A6 (RNASE6) Polyclonal Antibody (Human), FITC
4-PAD192Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RNASE6 (Pro25~Leu150) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A6 (RNASE6). This antibody is labeled with FITC.

Ribonuclease A6 (RNASE6) Polyclonal Antibody (Human), HRP
4-PAD192Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RNASE6 (Pro25~Leu150) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A6 (RNASE6). This antibody is labeled with HRP.

Ribonuclease A6 (RNASE6) Polyclonal Antibody (Human), PE
4-PAD192Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RNASE6 (Pro25~Leu150) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A6 (RNASE6). This antibody is labeled with PE.

Ribonuclease A6 (RNASE6) Polyclonal Antibody (Human), APC-Cy7
4-PAD192Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RNASE6 (Pro25~Leu150) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ribonuclease A6 (RNASE6). This antibody is labeled with APC-Cy7.

Human Ribonuclease K6, RNASE6 ELISA KIT
ELI-20360h	Lifescience Market	96 Tests	EUR 824

Bovine Ribonuclease K6, RNASE6 ELISA KIT
ELI-18073b	Lifescience Market	96 Tests	EUR 928

Mouse Ribonuclease K6, Rnase6 ELISA KIT
ELI-35801m	Lifescience Market	96 Tests	EUR 865

Porcine Ribonuclease K3, RNASE6 ELISA KIT
ELI-35802p	Lifescience Market	96 Tests	EUR 928

Recombinant Human Ribonuclease K6/RNASE6 (C-6His)
CA50-10ug	Novoprotein	10ug	EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mMDTT,10%Glycerol,pH7.5.

Recombinant Human Ribonuclease K6/RNASE6 (C-6His)
CA50-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mMDTT,10%Glycerol,pH7.5.

Recombinant Human Ribonuclease K6/RNASE6 (C-6His)
CA50-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mMDTT,10%Glycerol,pH7.5.

Recombinant Human Ribonuclease K6/RNASE6 (C-6His)
CA50-50ug	Novoprotein	50ug	EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mMDTT,10%Glycerol,pH7.5.

RNASE6 ELISA Kit (Human) (OKCD00371)
OKCD00371	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May have a role in host defense. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL

RNASE6 ELISA Kit (Human) (OKAN06167)
OKAN06167	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene is a member of the ribonuclease A superfamily and functions in the urinary tract. The protein has broad-spectrum antimicrobial activity against pathogenic bacteria.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5 pg/mL

RNASE6 ELISA Kit (Human) (OKDD00508)
OKDD00508	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene is a member of the ribonuclease A superfamily and functions in the urinary tract. The protein has broad-spectrum antimicrobial activity against pathogenic bacteria.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.064 ng/mL

RNASE6 ELISA Kit (Chicken) (OKEH07214)
OKEH07214	Aviva Systems Biology	96 Wells	EUR 962
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39pg/mL

Human Ribonuclease ELISA kit
E01R0357-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease ELISA kit
E01R0357-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease ELISA kit
E01R0357-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease ELISA Kit
ELA-E0297h	Lifescience Market	96 Tests	EUR 824

Carboxypeptidase A6 ELISA KIT|Human
EF008385	Lifescience Market	96 Tests	EUR 689

RNASE6 siRNA
20-abx931626	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNASE6 siRNA
20-abx931627	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human RNASE6 shRNA Plasmid
20-abx954090	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RNASE6 Recombinant Protein (Human)
RP026527	ABM	100 ug	Ask for price

Human Annexin A6 (ANXA6) ELISA Kit
abx570621-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Carboxypeptidase A6(CPA6) ELISA kit
E01C1994-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase A6(CPA6) ELISA kit
E01C1994-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase A6(CPA6) ELISA kit
E01C1994-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Serpin A6 PicoKine ELISA Kit
EK1963	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Serpin A6 in cell culture supernates, serum and plasma (heparin, EDTA) and urine.

Human ANXA6(Annexin A6) ELISA Kit
EH1625	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P08133 Alias: ANXA6/Annexin A6/Lipocortin VI/Chromobindin-20/Calphobindin-II/CPB-II/Annexin-6/p70/p68/Protein III/67 kDa calelectrin/Annexin VI/CBP68/Calelectrin/ANX6
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Carboxypeptidase A6, CPA6 ELISA KIT
ELI-25531h	Lifescience Market	96 Tests	EUR 824

Human Annexin A6, ANXA6 ELISA KIT
ELI-04772h	Lifescience Market	96 Tests	EUR 824

Human Annexin A6 (ANXA6) ELISA Kit
20-abx150672	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Carboxypeptidase A6 (CPA6) ELISA Kit
20-abx386292	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Golgin A6 (GOLGA6)ELISA Kit
201-12-2731	SunredBio	96 tests	EUR 440
This Golgin A6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
DLR-ANXA6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Annexin A6 (ANXA6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Annexin A6 (ANXA6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
DLR-ANXA6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Annexin A6 (ANXA6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Annexin A6 (ANXA6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human ANXA6/ Annexin A6 ELISA Kit
E0163Hu	Sunlong	1 Kit	EUR 571

Human Annexin A6 (ANXA6) ELISA Kit
SEC345Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
SEC345Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
SEC345Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
SEC345Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit
4-SEC345Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Annexin A6 elisa. Alternative names of the recognized antigen: ANX6 ANX-A6 CBP68 CPB-II Annexin VI 67 kDa calelectrin Calphobindin-II Chromobindin-20 Lipocortin VI
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Annexin A6 (ANXA6) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Annexin A6 ELISA Kit (ANXA6)
RK00904	Abclonal	96 Tests	EUR 521

Human Annexin A6 (ANXA6) ELISA Kit
RD-ANXA6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Annexin A6 (ANXA6) ELISA Kit
RD-ANXA6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Annexin A6 (ANXA6) ELISA Kit
RDR-ANXA6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Annexin A6 (ANXA6) ELISA Kit
RDR-ANXA6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Carboxypeptidase A6(CPA6)ELISA Kit
QY-E01346	Qayee Biotechnology	96T	EUR 361

Human Annexin A6(ANXA6)ELISA Kit
QY-E02146	Qayee Biotechnology	96T	EUR 361

Human Golgin A6(GOLGA6)ELISA Kit
QY-E03373	Qayee Biotechnology	96T	EUR 361

Human Ribonuclease Inhibitor ELISA kit
E01R0052-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease Inhibitor ELISA kit
E01R0052-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease Inhibitor ELISA kit
E01R0052-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease Inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease A ELISA kit
E01R0055-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease A ELISA kit
E01R0055-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease A ELISA kit
E01R0055-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease H ELISA kit
E01R0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease H ELISA kit
E01R0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease H ELISA kit
E01R0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease H in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease T2 ELISA kit
E01R0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease T2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease T2 ELISA kit
E01R0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease T2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribonuclease T2 ELISA kit
E01R0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Ribonuclease T2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human targeted ribonuclease ELISA Kit
ELA-E1382h	Lifescience Market	96 Tests	EUR 824

Human RNASE(Ribonuclease) ELISA Kit
EH3719	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Alias: RNASE
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Ribonuclease(RNASE)ELISA Kit
GA-E0783HM-48T	GenAsia Biotech	48T	EUR 289

Human Ribonuclease(RNASE)ELISA Kit
GA-E0783HM-96T	GenAsia Biotech	96T	EUR 466

Human Ribonuclease (RNASE) ELISA Kit
abx253109-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Ribonuclease,RNASE ELISA Kit
201-12-0767	SunredBio	96 tests	EUR 440
This Ribonuclease ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ribonuclease,RNASE ELISA Kit
CN-04532H1	ChemNorm	96T	EUR 447

Human Ribonuclease,RNASE ELISA Kit
CN-04532H2	ChemNorm	48T	EUR 296

Human Ribonuclease(RNASE)ELISA Kit
QY-E03180	Qayee Biotechnology	96T	EUR 361

RNASE6 Rabbit pAb
A15312-100ul	Abclonal	100 ul	EUR 308

RNASE6 Rabbit pAb
A15312-200ul	Abclonal	200 ul	EUR 459

RNASE6 Rabbit pAb
A15312-20ul	Abclonal	20 ul	EUR 183

RNASE6 Rabbit pAb
A15312-50ul	Abclonal	50 ul	EUR 223

RNASE6 Polyclonal Antibody
28911-100ul	SAB	100ul	EUR 252

RNASE6 Polyclonal Antibody
28911-50ul	SAB	50ul	EUR 187

RNASE6 cloning plasmid
CSB-CL839002HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 453 Sequence: atggtgctatgctttcctcttcttttactgctgctggttctatggggaccagtgtgtccacttcatgcttggcctaagcgtctcaccaaggctcactggtttgaaattcagcatatacagccaagtcctctccaatgcaacagggcaatgagtggcatcaacaattatacccagca Show more
Description: A cloning plasmid for the RNASE6 gene.

Anti-RNASE6 antibody
STJ117507	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the ribonuclease A superfamily and functions in the urinary tract. The protein has broad-spectrum antimicrobial activity against pathogenic bacteria.

Annexin A6 Cell ELISA Kit
abx595033-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Rat Ribonuclease ELISA kit
E02R0357-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribonuclease ELISA kit
E02R0357-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribonuclease ELISA kit
E02R0357-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribonuclease ELISA kit
E03R0357-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribonuclease ELISA kit
E03R0357-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribonuclease ELISA kit
E03R0357-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribonuclease ELISA kit
E04R0357-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribonuclease ELISA kit
E04R0357-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribonuclease ELISA kit
E04R0357-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ribonuclease ELISA kit
E06R0357-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ribonuclease ELISA kit
E06R0357-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ribonuclease ELISA kit
E06R0357-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ribonuclease ELISA kit
E07R0357-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ribonuclease ELISA kit
E07R0357-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ribonuclease ELISA kit
E07R0357-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ribonuclease ELISA kit
E08R0357-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ribonuclease ELISA kit
E08R0357-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ribonuclease ELISA kit
E08R0357-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ribonuclease ELISA kit
E09R0357-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ribonuclease ELISA kit
E09R0357-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ribonuclease ELISA kit
E09R0357-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ribonuclease in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RNASE6 ORF Vector (Human) (pORF)
ORF008843	ABM	1.0 ug DNA	EUR 95

ELISA kit for Human Protein S100-A6
EK3954	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein S100-A6 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human S100A6/ Protein S100-A6 ELISA Kit
E2196Hu	Sunlong	1 Kit	EUR 571

Human RNASE6(Ribonuclease A6) ELISA Kit