Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit
Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
RDR-POT1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
RD-POT1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
RD-POT1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Protection Of Telomeres 1 Homolog (POT1) Antibody |
20-abx178139 |
Abbexa |
|
|
|
Protection Of Telomeres 1 Homolog (POT1) Antibody |
20-abx174239 |
Abbexa |
|
|
|
Protection Of Telomeres 1 Homolog (POT1) Antibody |
20-abx325024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
20-abx152802 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
SEK108Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
SEK108Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
SEK108Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
SEK108Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protection Of Telomeres 1 Homolog (POT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protection Of Telomeres 1 Homolog (POT1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protection Of Telomeres 1 Homolog (POT1) ELISA Kit |
4-SEK108Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Protection Of Telomeres 1 Homolog elisa. Alternative names of the recognized antigen: hPot1
- POT1-like telomere end-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protection Of Telomeres 1 Homolog (POT1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Protection Of Telomeres 1 Homolog (POT1) Protein |
20-abx654836 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Protection Of Telomeres 1 Homolog (POT1) CLIA Kit |
20-abx495819 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human POT1 (Protection Of Telomeres 1 Homolog) |
ELK4349 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protection Of Telomeres 1 Homolog (POT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody speci
- Show more
|
Description: A sandwich ELISA kit for detection of Protection Of Telomeres 1 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Pot1 Protection of Telomeres 1 Homolog (S. Pombe) (POT1) Antibody |
20-abx114619 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
20-abx008212 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
abx217869-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
abx036150-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
abx236645-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
20-abx302412 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody |
20-abx001265 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Human Protection of Telomeres Protein 1 (POT1) ELISA Kit |
abx572962-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Protection of telomeres protein 1, POT1 ELISA KIT |
ELI-36535h |
Lifescience Market |
96 Tests |
EUR 824 |
Chicken Protection of telomeres protein 1, POT1 ELISA KIT |
ELI-45371c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Protection of telomeres protein 1, Pot1 ELISA KIT |
ELI-38106m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Human POT1 (Protection of Telomeres Protein 1) |
E-EL-H1968 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's POT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human POT1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human POT1 (Protection of Telomeres Protein 1) in samples from Serum, Plasma, Cell supernatant |
Protection of Telomeres Protein 1 (POT1) Antibody (HRP) |
20-abx317652 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody (FITC) |
20-abx317653 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protection of Telomeres Protein 1 (POT1) Antibody (Biotin) |
20-abx317654 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Chicken Protection of telomeres protein 1 (POT1) |
KTE30066-48T |
Abbkine |
48T |
EUR 354 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Protection of telomeres protein 1 (POT1) |
KTE30066-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Protection of telomeres protein 1 (POT1) |
KTE30066-96T |
Abbkine |
96T |
EUR 572 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protection of telomeres protein 1 (POT1) |
KTE70711-48T |
Abbkine |
48T |
EUR 332 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protection of telomeres protein 1 (POT1) |
KTE70711-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protection of telomeres protein 1 (POT1) |
KTE70711-96T |
Abbkine |
96T |
EUR 539 |
- POT1 is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere len
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protection of telomeres protein 1 (POT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
POT1 ELISA Kit (Human) (OKCD02026) |
OKCD02026 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Component of the telomerase ribonucleoprotein (RNP) complex that is essential for the replication of chromosome termini. Is a component of the double-stranded telomeric DNA-binding TRF1 complex which is involved in the regulation of telomere length by cis-inhibition of telomerase. Also acts as a single-stranded telomeric DNA-binding protein and thus may act as a downstream effector of the TRF1 complex and may transduce information about telomere maintenance and/or length to the telomere terminus. Component of the shelterin complex (telosome) that is involved in the regulation of telomere length and protection. Shelterin associates with arrays of double-stranded TTAGGG repeats added by telomerase and protects chromosome ends; without its protective activity, telomeres are no longer hidden from the DNA damage surveillance and chromosome ends are inappropriately processed by DNA repair pathways. Binds to two or more telomeric single-stranded 5'-TTAGGG-3' repeats (G-strand) and with high specificity to a minimal telomeric single-stranded 5'-TAGGGTTAG-3' sequence. Binds telomeric single-stranded sequences internally or at proximity of a 3'-end. Its activity is TERT dependent but it does not increase TERT activity by itself. In contrast, the ACD-POT1 heterodimer enhances telomere elongation by increasing telomerase processivity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.118 ng/mL |
POT1 ELISA Kit (Human) (OKCA02134) |
OKCA02134 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Component of the telomerase ribonucleoprotein (RNP) complex that is essential for the replication of chromosome termini. Is a component of the double-stranded telomeric DNA-binding TRF1 complex which is involved in the regulation of telomere length by cis-inhibition of telomerase. Also acts as a single-stranded telomeric DNA-binding protein and thus may act as a downstream effector of the TRF1 complex and may transduce information about telomere maintenance and/or length to the telomere terminus. Component of the shelterin complex (telosome) that is involved in the regulation of telomere length and protection. Shelterin associates with arrays of double-stranded TTAGGG repeats added by telomerase and protects chromosome ends; without its protective activity, telomeres are no longer hidden from the DNA damage surveillance and chromosome ends are inappropriately processed by DNA repair pathways. Binds to two or more telomeric single-stranded 5'-TTAGGG-3' repeats (G-strand) and with high specificity to a minimal telomeric single-stranded 5'-TAGGGTTAG-3' sequence. Binds telomeric single-stranded sequences internally or at proximity of a 3'-end. Its activity is TERT dependent but it does not increase TERT activity by itself. In contrast, the ACD-POT1 heterodimer enhances telomere elongation by increasing telomerase processivity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.72 pg/mL |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
DLR-EZH1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
DLR-EZH1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
20-abx151462 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human SOS1(Son of sevenless homolog 1) ELISA Kit |
EH12498 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Enhancer of polycomb homolog 1, EPC1 ELISA KIT |
ELI-09227h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Suppressor of SWI4 1 homolog, PPAN ELISA KIT |
ELI-18703h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Son of sevenless homolog 1, SOS1 ELISA KIT |
ELI-29100h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Enhancer of Polycomb Homolog 1 (EPC1) ELISA Kit |
abx384837-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Son Of Sevenless Homolog 1 (SOS1) ELISA Kit |
20-abx383374 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RDR-EZH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RDR-EZH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RD-EZH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RD-EZH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Human Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
4-SEK072Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Enhancer Of Zeste Homolog 1 elisa. Alternative names of the recognized antigen: KMT6B
- ENX-2
- Histone-lysine N-methyltransferase EZH1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enhancer Of Zeste Homolog 1 (EZH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit |
EI1770-1 |
AssayPro |
96 Well Plate |
EUR 477 |
POT1 antibody |
70R-19426 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal POT1 antibody |
POT1 Antibody |
43524-100ul |
SAB |
100ul |
EUR 252 |
POT1 Antibody |
1-CSB-PA003831 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
POT1 Antibody |
1-CSB-PA868326LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
POT1 Antibody |
DF8423 |
Affbiotech |
200ul |
EUR 304 |
Description: POT1 Antibody detects endogenous levels of total POT1. |
POT1 Antibody |
1-CSB-PA018382GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against POT1. Recognizes POT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
POT1 antibody |
70R-50924 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal POT1 antibody |
POT1 siRNA |
20-abx929286 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
POT1 siRNA |
20-abx929287 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-POT1 |
YF-PA25957 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to POT1 |
ELISA kit for Human EZH1 (Enhancer Of Zeste Homolog 1) |
ELK4457 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 1 (EZH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Establishment of Cohesion 1 Homolog 2 (ESCO2) ELISA Kit |
abx387194-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Son of sevenless homolog 1 (SOS1) |
KTE60555-48T |
Abbkine |
48T |
EUR 332 |
- Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Son of sevenless homolog 1 (SOS1) |
KTE60555-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Son of sevenless homolog 1 (SOS1) |
KTE60555-96T |
Abbkine |
96T |
EUR 539 |
- Son of sevenless homolog 1 (SOS1) is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS prot
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Enhancer of zeste homolog 2 ELISA kit |
E01E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of zeste homolog 2 ELISA kit |
E01E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of zeste homolog 2 ELISA kit |
E01E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of rudimentary homolog(ERH) ELISA kit |
E01E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of rudimentary homolog(ERH) ELISA kit |
E01E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of rudimentary homolog(ERH) ELISA kit |
E01E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Enhancer of rudimentary homolog, ERH ELISA KIT |
ELI-10027h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Suppressor of fused homolog, SUFU ELISA KIT |
ELI-18767h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Partner Of NOB1 Homolog (PNO1) ELISA Kit |
abx382328-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Enhancer Of Rudimentary Homolog (ERH) ELISA Kit |
abx387185-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
DLR-EZH1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates or other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
DLR-EZH1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from tissue homogenates or other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
20-abx153970 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Son of sevenless homolog 1, Sos1 ELISA KIT |
ELI-19946m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Enhancer of polycomb homolog 1, Epc1 ELISA KIT |
ELI-08640m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Suppressor of SWI4 1 homolog, Ppan ELISA KIT |
ELI-53449m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Enhancer of Polycomb Homolog 1 (EPC1) ELISA Kit |
abx389164-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RDR-EZH1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RDR-EZH1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RD-EZH1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
RD-EZH1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
SEK072Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enhancer Of Zeste Homolog 1 (EZH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in Tissue homogenates and other biological fluids. |
Mouse Enhancer Of Zeste Homolog 1 (EZH1) ELISA Kit |
4-SEK072Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Enhancer Of Zeste Homolog 1 elisa. Alternative names of the recognized antigen: KMT6B
- ENX-2
- Histone-lysine N-methyltransferase EZH1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Enhancer Of Zeste Homolog 1 (EZH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human POT1 shRNA Plasmid |
20-abx958584 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
POT1 Recombinant Protein (Human) |
RP024184 |
ABM |
100 ug |
Ask for price |
Human Suppressor of G2 allele of SKP1 homolog, SUGT1 ELISA KIT |
ELI-52628h |
Lifescience Market |
96 Tests |
EUR 824 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Epc1 ELISA Kit| Mouse Enhancer of polycomb homolog 1 ELISA Kit |
EF014794 |
Lifescience Market |
96 Tests |
EUR 689 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human Suppressor Of Variegation 3-9 Homolog 1 (SUV39H1) ELISA Kit |
abx383577-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Suppressor of SWI4 1 homolog (PPAN) |
1-CSB-YP868284HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 55.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Suppressor of SWI4 1 homolog(PPAN) expressed in Yeast |
Recombinant human Enhancer of polycomb homolog 1 |
P2704 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9H2F5
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Enhancer of polycomb homolog 1 |
Human Enhancer Of Zeste Homolog 1 (EZH1) CLIA Kit |
20-abx495815 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
POT1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1689102 |
ABM |
1.0 ug DNA |
EUR 154 |
POT1 Blocking Peptide |
DF8423-BP |
Affbiotech |
1mg |
EUR 195 |
POT1 Blocking Peptide |
20-abx063799 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
POT1 Conjugated Antibody |
C43524 |
SAB |
100ul |
EUR 397 |
POT1 cloning plasmid |
CSB-CL868326HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1905
- Sequence: atgtctttggttccagcaacaaattatatatatacacccctgaatcaacttaagggtggtacaattgtcaatgtctatggtgttgtgaagttctttaagcccccatatctaagcaaaggaactgattattgctcagttgtaactattgtggaccagacaaatgtaaaactaactt
- Show more
|
Description: A cloning plasmid for the POT1 gene. |
POT1 Polyclonal Antibody |
ABP52246-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human POT1
- Applications tips:
|
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1 |
POT1 Polyclonal Antibody |
ABP52246-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human POT1
- Applications tips:
|
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1 |
POT1 Polyclonal Antibody |
ABP52246-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human POT1
- Applications tips:
|
Description: A polyclonal antibody for detection of POT1 from Human, Monkey. This POT1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human POT1 |
POT1 Rabbit pAb |
A1491-100ul |
Abclonal |
100 ul |
EUR 308 |
POT1 Rabbit pAb |
A1491-200ul |
Abclonal |
200 ul |
EUR 459 |
POT1 Rabbit pAb |
A1491-20ul |
Abclonal |
20 ul |
EUR 183 |
POT1 Rabbit pAb |
A1491-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- POT1 antibody |
FNab06645 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: POT1 protection of telomeres 1 homolog (S. pombe)
- Uniprot ID: Q9NUX5
- Gene ID: 25913
- Research Area: Metabolism
|
Description: Antibody raised against POT1 |
POT1 Polyclonal Antibody |
ES3245-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against POT1 from Human/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA |
POT1 Polyclonal Antibody |
ES3245-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against POT1 from Human/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-POT1 Antibody |
PB9780 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-POT1 antibody |
STJ95185 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to POT1. |
Human Enhancer Of Zeste Homolog 2 (EZH2)ELISA Kit |
201-12-2672 |
SunredBio |
96 tests |
EUR 440 |
- This Enhancer Of Zeste Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
DLR-SUZ12-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from tissue homogenates or other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
DLR-SUZ12-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from tissue homogenates or other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
DLR-EZH2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
DLR-EZH2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
20-abx151463 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
20-abx153197 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human EZH2(Enhancer of zeste homolog 2) ELISA Kit |
EH4131 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: Q15910
- Alias: Histone-lysine N-methyltransferase EZH2/ENX-1/Enhancer of zeste homolog 2/Lysine N-methyltransferase 6/KMT6
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Modulator of retrovirus infection homolog, MRI ELISA KIT |
ELI-16489h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Son of sevenless homolog 2, SOS2 ELISA KIT |
ELI-19947h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Enhancer of polycomb homolog 2, EPC2 ELISA KIT |
ELI-26075h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Enhancer Of Yellow 2 Homolog (ENY2) ELISA Kit |
abx387157-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
RDR-EZH2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
RDR-EZH2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
RD-SUZ12-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
RD-SUZ12-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
RD-EZH2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
RD-EZH2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
RDR-SUZ12-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
RDR-SUZ12-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
SEK073Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
SEK073Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
SEK073Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
SEK073Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enhancer Of Zeste Homolog 2 (EZH2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit |
4-SEK073Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Enhancer Of Zeste Homolog 2 elisa. Alternative names of the recognized antigen: ENX-1
- KMT6
- KMT6A
- Histone-lysine N-methyltransferase EZH2
- Lysine N-methyltransferase 6
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
SEM329Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
SEM329Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
SEM329Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
SEM329Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Suppressor Of Zeste 12 Homolog (SUZ12) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in Tissue homogenates and other biological fluids. |
Human Suppressor Of Zeste 12 Homolog (SUZ12) ELISA Kit |
4-SEM329Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Suppressor Of Zeste 12 Homolog elisa. Alternative names of the recognized antigen: CHET9
- JJAZ1
- Chromatin precipitated E2F target 9 protein
- Joined to JAZF1 protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Suppressor Of Zeste 12 Homolog (SUZ12) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse EZH1 (Enhancer Of Zeste Homolog 1) |
ELK6993 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enhancer Of Zeste Homolog 1 (EZH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Enhancer Of Zeste Homolog 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Son of sevenless homolog 1 (SOS1) |
KTE70402-48T |
Abbkine |
48T |
EUR 332 |
- SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Son of sevenless homolog 1 (SOS1) |
KTE70402-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Son of sevenless homolog 1 (SOS1) |
KTE70402-96T |
Abbkine |
96T |
EUR 539 |
- SOS1 encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Son of sevenless homolog 1 (SOS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent) |
CASCL9-100A-KIT |
SBI |
1 Kit |
EUR 1132 |
|
POT1 ORF Vector (Human) (pORF) |
ORF008062 |
ABM |
1.0 ug DNA |
EUR 95 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human Enhancer Of Zeste Homolog 1 (EZH1) Protein |
20-abx650780 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bovine Suppressor of G2 allele of SKP1 homolog, SUGT1 ELISA KIT |
ELI-13668b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Suppressor of G2 allele of SKP1 homolog, Sugt1 ELISA KIT |
ELI-18768m |
Lifescience Market |
96 Tests |
EUR 865 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Anti-CELSR3/Flamingo Homolog 1 Antibody |
A07204-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
Rat Enhancer of rudimentary homolog(ERH) ELISA kit |
E02E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of rudimentary homolog(ERH) ELISA kit |
E02E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of rudimentary homolog(ERH) ELISA kit |
E02E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of zeste homolog 2 ELISA kit |
E02E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of zeste homolog 2 ELISA kit |
E02E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Enhancer of zeste homolog 2 ELISA kit |
E02E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of zeste homolog 2 ELISA kit |
E03E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of zeste homolog 2 ELISA kit |
E03E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of zeste homolog 2 ELISA kit |
E03E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of rudimentary homolog(ERH) ELISA kit |
E03E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of rudimentary homolog(ERH) ELISA kit |
E03E0384-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Enhancer of rudimentary homolog(ERH) ELISA kit |
E03E0384-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Enhancer of zeste homolog 2 ELISA kit |
E06E0069-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Enhancer of zeste homolog 2 ELISA kit |
E06E0069-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Enhancer of zeste homolog 2 ELISA kit |
E06E0069-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Enhancer of zeste homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Enhancer of rudimentary homolog(ERH) ELISA kit |
E06E0384-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Enhancer of rudimentary homolog(ERH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human POT1(Protection Of Telomeres 1 Homolog) ELISA Kit