Human NTSR2(Neurotensin Receptor 2) ELISA Kit

To Order: Contact us

Human Neurotensin Receptor 2 (NTSR2) ELISA Kit

RD-NTSR2-Hu-48Tests 48 Tests
EUR 521

Human Neurotensin Receptor 2 (NTSR2) ELISA Kit

RD-NTSR2-Hu-96Tests 96 Tests
EUR 723

Human Neurotensin Receptor 2 (NTSR2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neurotensin Receptor 2(NTSR2)ELISA Kit

QY-E01667 96T
EUR 361

Human Neurotensin Receptor 2 (NTSR2) ELISA Kit

SEC676Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin Receptor 2 (NTSR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurotensin Receptor 2 (NTSR2) in Tissue homogenates and other biological fluids.

Human Neurotensin Receptor 2 (NTSR2) ELISA Kit

SEC676Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin Receptor 2 (NTSR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurotensin Receptor 2 (NTSR2) in Tissue homogenates and other biological fluids.

Human Neurotensin Receptor 2 (NTSR2) ELISA Kit

SEC676Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin Receptor 2 (NTSR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurotensin Receptor 2 (NTSR2) in Tissue homogenates and other biological fluids.

Human Neurotensin Receptor 2 (NTSR2) ELISA Kit

SEC676Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin Receptor 2 (NTSR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurotensin Receptor 2 (NTSR2) in Tissue homogenates and other biological fluids.

Human Neurotensin Receptor 2 (NTSR2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurotensin Receptor 2 elisa. Alternative names of the recognized antigen: NTR2
  • Levocabastine-sensitive neurotensin receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurotensin Receptor 2 (NTSR2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Neurotensin Receptor 2 (NTSR2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurotensin Receptor 2 (NTSR2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurotensin Receptor 2 (NTSR2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Neurotensin Receptor 2 (NTSR2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurotensin Receptor 2 (NTSR2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurotensin Receptor 2 (NTSR2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Neurotensin Receptor 2 (NTSR2)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95665
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Neurotensin Receptor 2 expressed in: E.coli

Human Neurotensin Receptor 2 (NTSR2) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Neurotensin Receptor 2 (NTSR2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human NTSR2 (Neurotensin Receptor 2)

ELK4627 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurotensin Receptor 2 (NTSR2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neu
  • Show more
Description: A sandwich ELISA kit for detection of Neurotensin Receptor 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neurotensin receptor type 2, NTSR2 ELISA KIT

ELI-44865h 96 Tests
EUR 824

Mouse Neurotensin receptor type 2, Ntsr2 ELISA KIT

ELI-44498m 96 Tests
EUR 865

Rat Neurotensin Receptor Type 2 (NTSR2) ELISA Kit

abx354025-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Neurotensin Receptor 2 (NTSR2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurotensin Receptor 2 (NTSR2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurotensin Receptor 2 (NTSR2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Rat NTSR2 (Neurotensin Receptor Type 2)

E-EL-R1108 1 plate of 96 wells
EUR 534
  • Gentaur's NTSR2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat NTSR2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat NTSR2 (Neurotensin Receptor Type 2) in samples from Serum, Plasma, Cell supernatant

Ntsr2/ Rat Ntsr2 ELISA Kit

ELI-21353r 96 Tests
EUR 886

Neurotensin Receptor 2 (NTS2)

RA17100 100 ul
EUR 461

NTSR2 ELISA Kit (Human) (OKCD08223)

OKCD08223 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

NTSR2 ELISA Kit (Human) (OKDD00440)

OKDD00440 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL

Human Neurotensin ELISA kit

E01N0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neurotensin ELISA kit

E01N0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neurotensin ELISA kit

E01N0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Neurotensin receptor type 1, NTSR1 ELISA KIT

ELI-15038h 96 Tests
EUR 824

Neurotensin Receptor Type 2 (NTR2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurotensin Receptor Type 2 (NTR2) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Human Neurotensin,NT ELISA Kit

201-12-1319 96 tests
EUR 440
  • This Neurotensin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurotensin (NT) ELISA Kit

DLR-NT-Hu-48T 48T
EUR 498
  • Should the Human Neurotensin (NT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Neurotensin (NT) in samples from serum, plasma or other biological fluids.

Human Neurotensin (NT) ELISA Kit

DLR-NT-Hu-96T 96T
EUR 647
  • Should the Human Neurotensin (NT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Neurotensin (NT) in samples from serum, plasma or other biological fluids.

Human Neurotensin (NTS) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neurotensin (NTS) ELISA Kit

abx250648-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Neurotensin (NTS) ELISA Kit

abx252833-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human NTs(Neurotensin) ELISA Kit

EH1376 96T
EUR 524.1
  • Detection range: 1.56-100 pg/ml
  • Uniprot ID: P30990
  • Alias: NT(Neurotensin)/NTS/neuromedin N/NN/NT/(NT/N)/NTS1/NMN-125
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938pg/ml

Human Neurotensin (NT) ELISA Kit

CEB203Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurotensin (NT) in serum, plasma and other biological fluids.

Human Neurotensin (NT) ELISA Kit

CEB203Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurotensin (NT) in serum, plasma and other biological fluids.

Human Neurotensin (NT) ELISA Kit

CEB203Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurotensin (NT) in serum, plasma and other biological fluids.

Human Neurotensin (NT) ELISA Kit

CEB203Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurotensin (NT) in serum, plasma and other biological fluids.

Human Neurotensin (NT) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurotensin elisa. Alternative names of the recognized antigen: NTS
  • NTS1
  • NmN-125
  • NN
  • Tail peptide Neuromedin N
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Neurotensin (NT) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Neurotensin,NT ELISA Kit

CN-04609H1 96T
EUR 434

Human Neurotensin,NT ELISA Kit

CN-04609H2 48T
EUR 284

Human Neurotensin, NT ELISA Kit

CSB-E09144h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurotensin, NT in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neurotensin, NT ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neurotensin, NT in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Neurotensin (NTS) ELISA Kit

abx575382-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Neurotensin(NT)ELISA Kit

GA-E1335HM-48T 48T
EUR 289

Human Neurotensin(NT)ELISA Kit

GA-E1335HM-96T 96T
EUR 466

Human Neurotensin(NT)ELISA Kit

QY-E01668 96T
EUR 361

Human Neurotensin ELISA Kit (NT)

RK01967 96 Tests
EUR 521

Human Neurotensin (NT) ELISA Kit

RDR-NT-Hu-48Tests 48 Tests
EUR 522

Human Neurotensin (NT) ELISA Kit

RDR-NT-Hu-96Tests 96 Tests
EUR 724

Human Neurotensin (NT) ELISA Kit

RD-NT-Hu-48Tests 48 Tests
EUR 500

Human Neurotensin (NT) ELISA Kit

RD-NT-Hu-96Tests 96 Tests
EUR 692

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

DLR-NTSR1-Hu-48T 48T
EUR 517
  • Should the Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neurotensin Receptor 1, High Affinity (NTSR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

DLR-NTSR1-Hu-96T 96T
EUR 673
  • Should the Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neurotensin Receptor 1, High Affinity (NTSR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

SEC826Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin Receptor 1, High Affinity (NTSR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurotensin Receptor 1, High Affinity (NTSR1) in Tissue homogenates, cell lysates and other biological fluids.

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

SEC826Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin Receptor 1, High Affinity (NTSR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurotensin Receptor 1, High Affinity (NTSR1) in Tissue homogenates, cell lysates and other biological fluids.

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

SEC826Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin Receptor 1, High Affinity (NTSR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurotensin Receptor 1, High Affinity (NTSR1) in Tissue homogenates, cell lysates and other biological fluids.

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

SEC826Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurotensin Receptor 1, High Affinity (NTSR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurotensin Receptor 1, High Affinity (NTSR1) in Tissue homogenates, cell lysates and other biological fluids.

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurotensin Receptor 1, High Affinity elisa. Alternative names of the recognized antigen: NTR
  • NTRH
  • NTRR
  • High-affinity levocabastine-insensitive neurotensin receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurotensin Receptor 1, High Affinity (NTSR1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

RDR-NTSR1-Hu-48Tests 48 Tests
EUR 544

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

RDR-NTSR1-Hu-96Tests 96 Tests
EUR 756

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

RD-NTSR1-Hu-48Tests 48 Tests
EUR 521

Human Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

RD-NTSR1-Hu-96Tests 96 Tests
EUR 723

NTSR2 ELISA Kit (Rat) (OKEI00881)

OKEI00881 96 Wells
EUR 767
Description: Description of target: Receptor for the tridecapeptide neurotensin. It is associated with G proteins that activate a phosphatidylinositol-calcium second messenger system. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Neurotensin Receptor 1 (NTS1)

CH14110 100 ul
EUR 400

Neurotensin Receptor 1 (NTS1)

GP14020 50 ul
EUR 243

Neurotensin Receptor 1 (NTS1)

P14020 100 ug Blocking Peptide
EUR 146

Mouse Neurotensin receptor type 1, Ntsr1 ELISA KIT

ELI-15113m 96 Tests
EUR 865

Rat Neurotensin ELISA kit

E02N0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neurotensin ELISA kit

E02N0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neurotensin ELISA kit

E02N0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Neurotensin ELISA kit

E04N0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Neurotensin ELISA kit

E04N0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Neurotensin ELISA kit

E04N0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Neurotensin ELISA kit

E03N0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Neurotensin ELISA kit

E03N0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Neurotensin ELISA kit

E03N0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Neurotensin ELISA kit

E06N0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Neurotensin ELISA kit

E06N0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Neurotensin ELISA kit

E06N0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Neurotensin ELISA kit

E08N0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Neurotensin ELISA kit

E08N0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Neurotensin ELISA kit

E08N0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Neurotensin ELISA kit

E07N0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Neurotensin ELISA kit

E07N0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Neurotensin ELISA kit

E07N0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Neurotensin ELISA kit

E09N0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Neurotensin ELISA kit

E09N0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Neurotensin ELISA kit

E09N0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neurotensin receptor 1 (NTR1) Control/blocking peptide # 2

NTR12-P 100 ug
EUR 164

Rabbit Anti-Human Neurotensin receptor 1 (NTR1) antiserum #2

NTR12-S 100 ul
EUR 457

ELISA kit for Human NTSR1 (Neurotensin Receptor 1, High Affinity)

ELK4586 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurotensin Receptor 1, High Affinity (NTSR1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody
  • Show more
Description: A sandwich ELISA kit for detection of Neurotensin Receptor 1, High Affinity from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

NTSR2 Antibody

37000-100ul 100ul
EUR 252

NTSR2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NTSR2. Recognizes NTSR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

NTSR2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NTSR2. Recognizes NTSR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NTSR2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NTSR2. Recognizes NTSR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ELISA kit for Human NT (Neurotensin)

E-EL-H1886 1 plate of 96 wells
EUR 534
  • Gentaur's NT ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Human NT. During the reaction, Human NT in the sample or standard competes with a fixed amount of Human NT on the sol
  • Show more
Description: A competitive ELISA kit for quantitative measurement of Human NT (Neurotensin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human NT (Neurotensin)

ELK1802 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Neurotensin (NT) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neurotensin (NT) and unlabeled Neurotensin (NT) (Standards or samples) with the pre-coated
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Neurotensin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Neurotensin Receptor 3 (NTS3)/Sortilin

GT15237 100 ug
EUR 526

Neurotensin Receptor 3 (NTS3)/Sortilin

GT15238 100 ug
EUR 526

Neurotensin Receptor 3 (NTS3)/Sortilin

RA25040 100 ul
EUR 552

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

DLR-NTSR1-Mu-48T 48T
EUR 527
  • Should the Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) in samples from tissue homogenates or other biological fluids.

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

DLR-NTSR1-Mu-96T 96T
EUR 688
  • Should the Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) in samples from tissue homogenates or other biological fluids.

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

SEC826Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) in Tissue homogenates and other biological fluids.

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

SEC826Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) in Tissue homogenates and other biological fluids.

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

SEC826Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) in Tissue homogenates and other biological fluids.

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

SEC826Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) in Tissue homogenates and other biological fluids.

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurotensin Receptor 1, High Affinity elisa. Alternative names of the recognized antigen: NTR
  • NTRH
  • NTRR
  • High-affinity levocabastine-insensitive neurotensin receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Neurotensin Receptor 1, High Affinity (NTSR1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

RDR-NTSR1-Mu-48Tests 48 Tests
EUR 557

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

RDR-NTSR1-Mu-96Tests 96 Tests
EUR 774

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

RD-NTSR1-Mu-48Tests 48 Tests
EUR 533

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) ELISA Kit

RD-NTSR1-Mu-96Tests 96 Tests
EUR 740

NTSR2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1462403 1.0 ug DNA
EUR 154

Human NTSR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NTSR2 Recombinant Protein (Human)

RP021793 100 ug Ask for price


5-01618 4 x 5mg Ask for price


B5226-1 1 mg
EUR 139
Description: IC50: N/ANeurotensin (NT) can activate the G protein-coupled receptor, the neurotensin receptor 1 (NTR1). NT, a 13-amino acid neuropeptide, expressed in the central nervous system, and the intestine, including ileum3 and colon.


B5226-10 10 mg
EUR 429
Description: IC50: N/ANeurotensin (NT) can activate the G protein-coupled receptor, the neurotensin receptor 1 (NTR1). NT, a 13-amino acid neuropeptide, expressed in the central nervous system, and the intestine, including ileum3 and colon.


B5226-25 25 mg
EUR 809
Description: IC50: N/ANeurotensin (NT) can activate the G protein-coupled receptor, the neurotensin receptor 1 (NTR1). NT, a 13-amino acid neuropeptide, expressed in the central nervous system, and the intestine, including ileum3 and colon.


B5226-5 5 mg
EUR 321
Description: IC50: N/ANeurotensin (NT) can activate the G protein-coupled receptor, the neurotensin receptor 1 (NTR1). NT, a 13-amino acid neuropeptide, expressed in the central nervous system, and the intestine, including ileum3 and colon.


HY-P0234 25mg
EUR 628


H-4435.0005 5.0mg
EUR 151
Description: Sum Formula: C78H121N21O20; CAS# [55508-42-4] net


H-4435.0025 25.0mg
EUR 515
Description: Sum Formula: C78H121N21O20; CAS# [55508-42-4] net


RA20072 100 ul
EUR 422


RA21024 50 ug
EUR 344

Rat Neurotensin (NT) ELISA Kit

DLR-NT-Ra-48T 48T
EUR 528
  • Should the Rat Neurotensin (NT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neurotensin (NT) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Neurotensin (NT) ELISA Kit

DLR-NT-Ra-96T 96T
EUR 690
  • Should the Rat Neurotensin (NT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Neurotensin (NT) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse neurotensin (NTS) ELISA kit

CSB-EL016136MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse neurotensin (NTS) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse neurotensin (NTS) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse neurotensin (NTS) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat neurotensin (NTS) ELISA kit

CSB-EL016136RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat neurotensin (NTS) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat neurotensin (NTS) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat neurotensin (NTS) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Guinea pig Neurotensin ELISA kit

E05N0036-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Neurotensin ELISA kit

E05N0036-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Neurotensin ELISA kit

E05N0036-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Neurotensin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neurotensin (NTS) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Neurotensin (NTS) ELISA Kit

abx254894-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Neurotensin (NTS) ELISA Kit

abx256443-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Chicken Neurotensin, NTS ELISA KIT

ELI-03986c 96 Tests
EUR 928

Rat Neurotensin (NT) ELISA Kit

CEB203Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neurotensin (NT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neurotensin (NT) ELISA Kit

CEB203Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neurotensin (NT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neurotensin (NT) ELISA Kit

CEB203Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neurotensin (NT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neurotensin (NT) ELISA Kit

CEB203Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Neurotensin (NT) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neurotensin (NT) ELISA Kit

  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurotensin elisa. Alternative names of the recognized antigen: NTS
  • NTS1
  • NmN-125
  • NN
  • Tail peptide Neuromedin N
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Neurotensin (NT) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Chicken Neurotensin (NTS) ELISA Kit

abx354732-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Neurotensin (NTS) ELISA Kit

abx355043-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Neurotensin (NTS) ELISA Kit

abx355187-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Neurotensin (NTS) ELISA Kit

abx355295-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Neurotensin (NTS) ELISA Kit

abx355406-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Cow Neurotensin (NTS) ELISA Kit

abx515761-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Neurotensin (NTS) ELISA Kit

abx515763-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Neurotensin ELISA Kit (NT)

RK03851 96 Tests
EUR 521

Canine Neurotensin,NT ELISA Kit

QY-E70090 96T
EUR 426

Rat Neurotensin (NT) ELISA Kit

RDR-NT-Ra-48Tests 48 Tests
EUR 558

Rat Neurotensin (NT) ELISA Kit

RDR-NT-Ra-96Tests 96 Tests
EUR 776

Rat Neurotensin (NT) ELISA Kit

RD-NT-Ra-48Tests 48 Tests
EUR 534

Rat Neurotensin (NT) ELISA Kit

RD-NT-Ra-96Tests 96 Tests
EUR 742

Human Neurotensin Receptor 1, High Affinity (NTSR1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human High Sensitive Neurotensin (NTS) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

ELISA kit for Human Neurotensin/neuromedin N

EK2948 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neurotensin/neuromedin N in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NTS/ Neurotensin/neuromedin N ELISA Kit

E1808Hu 1 Kit
EUR 571

Human Neurotensin/neuromedin N, NTS ELISA KIT

ELI-03989h 96 Tests
EUR 824

High Sensitive Human Neurotensin (NT) ELISA Kit

HEB203Hu-10x96wellstestplate 10x96-wells test plate
EUR 4940.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurotensin (NT) in serum, plasma and other biological fluids.

High Sensitive Human Neurotensin (NT) ELISA Kit

HEB203Hu-1x48wellstestplate 1x48-wells test plate
EUR 494.55
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurotensin (NT) in serum, plasma and other biological fluids.

High Sensitive Human Neurotensin (NT) ELISA Kit

HEB203Hu-1x96wellstestplate 1x96-wells test plate
EUR 663.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurotensin (NT) in serum, plasma and other biological fluids.

High Sensitive Human Neurotensin (NT) ELISA Kit

HEB203Hu-5x96wellstestplate 5x96-wells test plate
EUR 2686.38
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Neurotensin (NT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurotensin (NT) in serum, plasma and other biological fluids.

High Sensitive Human Neurotensin (NT) ELISA Kit

  • EUR 4991.00
  • EUR 2637.00
  • EUR 664.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurotensin elisa. Alternative names of the recognized antigen: NTS
  • NTS1
  • NmN-125
  • NN
  • Tail peptide Neuromedin N
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of High Sensitive Human Neurotensin (NT) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Neurotensin receptor 2 (NTR2) Control/blocking peptide # 1

NTR21-P 100 ug
EUR 164

Rabbit Anti-Rat Neurotensin receptor 2 (NTR2) antiserum # 1

NTR21-S 100 ul
EUR 457

Human Neurotensin (NT) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neurotensin Antibody

33420-05111 150 ug
EUR 261

ELISA kit for Mouse NTSR1 (Neurotensin Receptor 1, High Affinity)

ELK7200 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurotensin Receptor 1, High Affinity (NTSR1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody
  • Show more
Description: A sandwich ELISA kit for detection of Neurotensin Receptor 1, High Affinity from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

NTSR2 Conjugated Antibody

C37000 100ul
EUR 397

NTSR2 cloning plasmid

CSB-CL016138HU-10ug 10ug
EUR 433
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1155
  • Sequence: atggaaaccagcagcccgcggccaccgcggcccagctcaaacccggggctgagcctggacgcccggctgggcgtggacactcgcctctgggccaaggtgctgttcaccgcgctctacgcactcatctgggcgctgggcgcggcgggcaatgcgctgtccgtgcacgtggtgctga
  • Show more
Description: A cloning plasmid for the NTSR2 gene.

pBluescriptR-NTSR2 Plasmid

PVT17015 2 ug
EUR 325

Neurotensin Receptor Type 1 (NTR1) Antibody

abx215882-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Neurotensin Receptor Type 1 (NTR1) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Polyclonal Neurotensin Receptor 1 (extracellular) Antibody

AMM06650G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Neurotensin Receptor 1 (extracellular) . This antibody is tested and proven to work in the following applications:

Rabbit Anti-Human Neurotensin receptor 1 (NTR1) IgG # 2, aff pure

NTR12-A 100 ug
EUR 482

Anti-VEGF Receptor 2/KDR Antibody

A00901-2 100ug/vial
EUR 334

Anti-Adiponectin Receptor 2 (mouse) Antibody

A02218-2 200ug
EUR 498
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.

Human Neurotensin Receptor 1, High Affinity (NTSR1) Protein

  • EUR 634.00
  • EUR 272.00
  • EUR 1901.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9

PROTQ99969-2 Regular: 5ug
EUR 317
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

NTSR2 ORF Vector (Human) (pORF)

ORF007265 1.0 ug DNA
EUR 95

Guinea pig Neurotensin (NTS) ELISA Kit

abx354854-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Rat NT (Neurotensin)

ELK6069 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Neurotensin (NT) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neurotensin (NT) and unlabeled Neurotensin (NT) (Standards or samples) with the pre-coated
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Neurotensin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein

PROTP20333-2 Regular: 20ug
EUR 317
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques.

Ntsr2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6982303 1.0 ug DNA
EUR 154

Ntsr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3711303 1.0 ug DNA
EUR 154

Neurotensin (Frog)

5-01624 4 x 5mg Ask for price

[Gln4] Neurotensin

5-00192 4 x 5mg Ask for price


5-00311 4 x 5mg Ask for price

Neurotensin Peptide

  • EUR 370.00
  • EUR 565.00
  • EUR 286.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Neurotensin Peptide

  • EUR 328.00
  • EUR 481.00
  • EUR 272.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Neurotensin Peptide

  • EUR 537.00
  • EUR 899.00
  • EUR 384.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.


H-7130.0005 5.0mg
EUR 273
Description: Sum Formula: C80H122N22O19; CAS# [75644-95-0]


H-7130.0025 25.0mg
EUR 998
Description: Sum Formula: C80H122N22O19; CAS# [75644-95-0]

Neurotensin antibody

Y130 50 ul
EUR 427
Description: The Neurotensin antibody is available in Europe and for worldwide shipping via Gentaur.


YF-PA13500 50 ug
EUR 363
Description: Mouse polyclonal to Neurotensin


YF-PA13501 100 ug
EUR 403
Description: Rabbit polyclonal to Neurotensin

Mouse Neurotensin Receptor 1, High Affinity (NTSR1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Neurotensin Receptor 1, High Affinity (NTSR1) Antibody

abx217256-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Neurotensin Receptor 1, High Affinity (NTSR1) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurotensin Receptor 1, High Affinity (NTSR1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurotensin Receptor 1, High Affinity (NTSR1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurotensin Receptor 1, High Affinity (NTSR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurotensin Receptor 1, High Affinity (NTSR1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurotensin Receptor 1, High Affinity (NTSR1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neurotensin Receptor 1, High Affinity (NTSR1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurotensin Receptor 1, High Affinity (NTSR1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurotensin Receptor 3 (NTS3)/Sortilin, Carrier Free

PR15080CF 50 ug
EUR 461

Human Neurotensin (NT) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Neurotensin (NT) Protein

  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

NTSR2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NTSR2. Recognizes NTSR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NTSR2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NTSR2. Recognizes NTSR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NTSR2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NTSR2. Recognizes NTSR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse NTSR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NTSR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NTSR2 Recombinant Protein (Mouse)

RP155306 100 ug Ask for price

NTSR2 Recombinant Protein (Rat)

RP214724 100 ug Ask for price

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Neurotensin receptor 3 (NTR3) Control/blocking peptide # 1

NTR31-P 100 ug
EUR 164

Rabbit Anti-Human Neurotensin receptor 3 (NTR3) antiserum # 1

NTR31-S 100 ul
EUR 457

Human NTSR2(Neurotensin Receptor 2) ELISA Kit