Human NINJ1(Ninjurin 1) ELISA Kit
Human NINJ1(Ninjurin 1) ELISA Kit
Human Ninjurin 1 (NINJ1) ELISA Kit |
RDR-NINJ1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Ninjurin 1 (NINJ1) ELISA Kit |
RDR-NINJ1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Ninjurin 1 (NINJ1) ELISA Kit |
RD-NINJ1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Ninjurin 1 (NINJ1) ELISA Kit |
RD-NINJ1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Ninjurin-1(NINJ1) ELISA kit |
CSB-EL015808HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-1 (NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Ninjurin-1(NINJ1) ELISA kit |
1-CSB-EL015808HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-1(NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Ninjurin 1 (NINJ1) ELISA Kit |
20-abx152526 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Ninjurin 1 (NINJ1) ELISA Kit |
SEH541Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Ninjurin 1 (NINJ1) ELISA Kit |
SEH541Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Ninjurin 1 (NINJ1) ELISA Kit |
SEH541Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Ninjurin 1 (NINJ1) ELISA Kit |
SEH541Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ninjurin 1 (NINJ1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ninjurin 1 (NINJ1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Ninjurin 1 (NINJ1) ELISA Kit |
4-SEH541Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Ninjurin 1 elisa. Alternative names of the recognized antigen: NIN1
- Nerve Injury-Induced Protein-1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ninjurin 1 (NINJ1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Ninjurin 1 (NINJ1) Antibody |
20-abx177810 |
Abbexa |
|
|
|
Ninjurin 1 (NINJ1) Antibody |
20-abx173830 |
Abbexa |
|
|
|
Ninjurin-1 (NINJ1) Antibody |
20-abx302043 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Ninjurin-1(NINJ1) ELISA kit |
CSB-EL015808MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Ninjurin-1 (NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Ninjurin-1(NINJ1) ELISA kit |
1-CSB-EL015808MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Ninjurin-1(NINJ1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Ninjurin-1 (NINJ1) ELISA Kit |
abx391714-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Ninjurin-1 (NINJ1) ELISA Kit |
abx390057-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human NINJ1 (Ninjurin 1) |
ELK4538 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ninjurin 1 (NINJ1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ninjurin 1 (NIN
- Show more
|
Description: A sandwich ELISA kit for detection of Ninjurin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Ninjurin 1 (NINJ1) Protein |
20-abx654563 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Ninjurin 1 (NINJ1) CLIA Kit |
20-abx495469 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Ninjurin-1 (NINJ1) Antibody (HRP) |
20-abx310403 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ninjurin-1 (NINJ1) Antibody (FITC) |
20-abx310404 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ninjurin-1 (NINJ1) Antibody (Biotin) |
20-abx310405 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Polyclonal NINJ1 / Ninjurin Antibody (C-Terminus) |
AMM06695G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NINJ1 / Ninjurin (C-Terminus). This antibody is tested and proven to work in the following applications: |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Ninjurin 1 antibody |
70R-6116 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Ninjurin 1 antibody raised against the N terminal of NINJ1 |
anti-Ninjurin 1 |
YF-PA13448 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Ninjurin 1 |
NINJ1 ELISA Kit (Human) (OKCD01958) |
OKCD01958 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.111 ng/mL |
NINJ1 ELISA Kit (Human) (OKCA02127) |
OKCA02127 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL |
Human Ninjurin-2(NINJ2) ELISA kit |
CSB-EL015809HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-2 (NINJ2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Ninjurin-2(NINJ2) ELISA kit |
1-CSB-EL015809HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Ninjurin-2(NINJ2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Ninjurin 2 (NINJ2) ELISA Kit |
abx381803-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Ninjurin 1 Blocking Peptide |
33R-2165 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NINJ1 antibody, catalog no. 70R-6116 |
Anti-Ninjurin 1 (2G5) |
YF-MA14464 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to Ninjurin 1 |
Human NINJ2 (Ninjurin- 2) ELISA Kit (Sandwich ELISA KIT) |
ELI-35326h |
Lifescience Market |
96 Tests |
EUR 824 |
NINJ1 ELISA Kit (Mouse) (OKCA01735) |
OKCA01735 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL |
NINJ1 Antibody |
1-CSB-PA856441LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
NINJ1 siRNA |
20-abx903564 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NINJ1 siRNA |
20-abx925907 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NINJ1 siRNA |
20-abx925908 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Rat NINJ2 (Ninjurin- 2) ELISA Kit (Sandwich ELISA KIT) |
ELI-13654r |
Lifescience Market |
96 Tests |
EUR 886 |
Mouse NINJ2 (Ninjurin- 2) ELISA Kit (Sandwich ELISA KIT) |
ELI-16706m |
Lifescience Market |
96 Tests |
EUR 865 |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human NINJ1 shRNA Plasmid |
20-abx953196 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NINJ1 Recombinant Protein (Human) |
RP021229 |
ABM |
100 ug |
Ask for price |
NINJ1 Recombinant Protein (Human) |
RP021232 |
ABM |
100 ug |
Ask for price |
NINJ1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1427602 |
ABM |
1.0 ug DNA |
EUR 154 |
Ninjurin 2 (NINJ2) Antibody |
20-abx114118 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ninjurin 2 (NINJ2) Antibody |
abx235733-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Ninjurin 2 (NINJ2) Antibody |
abx235734-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Ninjurin 2 (NINJ2) Antibody |
20-abx302074 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NINJ1 Polyclonal Antibody |
29832-100ul |
SAB |
100ul |
EUR 252 |
NINJ1 Polyclonal Antibody |
29832-50ul |
SAB |
50ul |
EUR 187 |
Polyclonal NINJ1 Antibody |
AMM06696G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NINJ1 . This antibody is tested and proven to work in the following applications: |
NINJ1 cloning plasmid |
CSB-CL856441HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 459
- Sequence: atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggc
- Show more
|
Description: A cloning plasmid for the NINJ1 gene. |
NINJ1 cloning plasmid |
CSB-CL856441HU2-10ug |
Cusabio |
10ug |
EUR 238 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 459
- Sequence: atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggc
- Show more
|
Description: A cloning plasmid for the NINJ1 gene. |
NINJ1 Polyclonal Antibody |
A67086 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
NINJ1 Rabbit pAb |
A16406-100ul |
Abclonal |
100 ul |
EUR 308 |
NINJ1 Rabbit pAb |
A16406-200ul |
Abclonal |
200 ul |
EUR 459 |
NINJ1 Rabbit pAb |
A16406-20ul |
Abclonal |
20 ul |
EUR 183 |
NINJ1 Rabbit pAb |
A16406-50ul |
Abclonal |
50 ul |
EUR 223 |
NINJ1 Polyclonal Antibody |
ABP59466-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein |
NINJ1 Polyclonal Antibody |
ABP59466-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein |
NINJ1 Polyclonal Antibody |
ABP59466-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NINJ1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NINJ1 from Human, Mouse, Rat. This NINJ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NINJ1 protein |
NINJ1 Polyclonal Antibody |
ES11146-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NINJ1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NINJ1 Polyclonal Antibody |
ES11146-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NINJ1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-NINJ1 antibody |
STJ192304 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NINJ1 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
NINJ1 ORF Vector (Human) (pORF) |
ORF007077 |
ABM |
1.0 ug DNA |
EUR 95 |
NINJ1 ORF Vector (Human) (pORF) |
ORF007078 |
ABM |
1.0 ug DNA |
EUR 95 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Ninjurin 2 (NINJ2) Antibody (HRP) |
20-abx311878 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ninjurin 2 (NINJ2) Antibody (FITC) |
20-abx311879 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ninjurin 2 (NINJ2) Antibody (Biotin) |
20-abx311880 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
NINJ1 Antibody, HRP conjugated |
1-CSB-PA856441LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NINJ1 Antibody, FITC conjugated |
1-CSB-PA856441LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NINJ1 Antibody, Biotin conjugated |
1-CSB-PA856441LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NINJ1. Recognizes NINJ1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mouse NINJ1 shRNA Plasmid |
20-abx971750 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NINJ1 shRNA Plasmid |
20-abx984940 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NINJ1 Polyclonal Conjugated Antibody |
C29832 |
SAB |
100ul |
EUR 397 |
NINJ1 Recombinant Protein (Mouse) |
RP154112 |
ABM |
100 ug |
Ask for price |
NINJ1 Recombinant Protein (Rat) |
RP213935 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Ninj1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6930802 |
ABM |
1.0 ug DNA |
EUR 154 |
Ninj1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3656802 |
ABM |
1.0 ug DNA |
EUR 154 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
NINJ1 sgRNA CRISPR Lentivector set (Human) |
K1427601 |
ABM |
3 x 1.0 ug |
EUR 339 |
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit |
EL3502-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human TGF-beta-1 AssayMax ELISA Kit |
ET3102-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human PAI-1/tPA AssayMax ELISA Kit |
EP1105-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
EI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit |
EI2301-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit |
EP1100-1 |
AssayPro |
96 Well Plate |
EUR 417 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit |
EC5752-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5001-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5101-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit |
EA5501-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit |
EE2702-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Glutathione Transferase zeta 1 AssayMax ELISA Kit |
EG2350-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit |
EG3928-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit |
EM5110-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
NINJ1 Polyclonal Antibody, HRP Conjugated |
A67087 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
NINJ1 Polyclonal Antibody, FITC Conjugated |
A67088 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
NINJ1 Polyclonal Antibody, Biotin Conjugated |
A67089 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Ninj1 ORF Vector (Rat) (pORF) |
ORF071313 |
ABM |
1.0 ug DNA |
EUR 506 |
Ninj1 ORF Vector (Mouse) (pORF) |
ORF051372 |
ABM |
1.0 ug DNA |
EUR 506 |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit |
EH5215-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit |
EI1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
NINJ1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1427603 |
ABM |
1.0 ug DNA |
EUR 154 |
NINJ1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1427604 |
ABM |
1.0 ug DNA |
EUR 154 |
NINJ1 Protein Vector (Human) (pPB-C-His) |
PV028305 |
ABM |
500 ng |
EUR 329 |
Human NINJ1(Ninjurin 1) ELISA Kit