Human MATR3(Matrin 3) ELISA Kit

To Order: Contact us

Human Matrin 3 (MATR3) ELISA Kit

RD-MATR3-Hu-48Tests 48 Tests
EUR 521

Human Matrin 3 (MATR3) ELISA Kit

RD-MATR3-Hu-96Tests 96 Tests
EUR 723

Human Matrin-3(MATR3) ELISA kit

CSB-EL013525HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3 (MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Matrin-3(MATR3) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3(MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Matrin 3 (MATR3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Matrin- 3, MATR3 ELISA KIT

ELI-15736h 96 Tests
EUR 824

Human Matrin 3(MATR3)ELISA Kit

QY-E04807 96T
EUR 361

Human Matrin 3 (MATR3) ELISA Kit

SEH678Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit

SEH678Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit

SEH678Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit

SEH678Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Matrin 3 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Matrin 3 (MATR3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Matrin- 3, Matr3 ELISA KIT

ELI-19577m 96 Tests
EUR 865

Rat Matrin 3 (MATR3) ELISA Kit

abx391583-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Matrin 3 (MATR3) ELISA Kit

abx389823-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Matrin 3 (MATR3) Antibody

abx018181-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Matrin 3 (MATR3) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrin 3 (MATR3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrin 3 (MATR3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrin 3 (MATR3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Matrin 3 (MATR3) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Matrin 3 (MATR3) Antibody

abx235030-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

ELISA kit for Human MATR3 (Matrin 3)

ELK4592 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrin 3 (MATR3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrin 3 (MATR3).
  • Show more
Description: A sandwich ELISA kit for detection of Matrin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Matrin-3 (MATR3)

KTE61708-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrin-3 (MATR3)

KTE61708-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrin-3 (MATR3)

KTE61708-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Matrin 3 (MATR3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Matrin 3 (MATR3) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Rat Matrin-3 (MATR3)

KTE100657-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Matrin-3 (MATR3)

KTE100657-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Matrin-3 (MATR3)

KTE100657-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrin-3 (MATR3)

KTE71110-48T 48T
EUR 332
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrin-3 (MATR3)

KTE71110-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrin-3 (MATR3)

KTE71110-96T 96T
EUR 539
  • Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Matr3 ELISA Kit| Rat Matrin-3 ELISA Kit

EF018941 96 Tests
EUR 689

Matr3 ELISA Kit| Mouse Matrin-3 ELISA Kit

EF015458 96 Tests
EUR 689

Matr3/ Rat Matr3 ELISA Kit

ELI-15737r 96 Tests
EUR 886


EF010852 96 Tests
EUR 689

MATR3 ELISA Kit (Human) (OKCD01966)

OKCD01966 96 Wells
EUR 831
Description: Description of target: May play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. In association with the SFPQ-NONO heteromer may play a role in nuclear retention of defective RNAs.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL

Matrin 3 antibody

70R-1389 100 ug
EUR 377
Description: Rabbit polyclonal Matrin 3 antibody raised against the N terminal of MATR3

Matrin 3 antibody

70R-1390 100 ug
EUR 377
Description: Rabbit polyclonal Matrin 3 antibody raised against the C terminal of MATR3

Matrin 3 Antibody

49779-100ul 100ul
EUR 333

Matrin 3 Antibody

49779-50ul 50ul
EUR 239

Human Zinc Finger, Matrin Type Protein 3 ELISA Kit

ELA-E3578h 96 Tests
EUR 824

Matrin 3 Blocking Peptide

33R-1084 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PYGB antibody, catalog no. 70R-2604

Matrin 3 Blocking Peptide

33R-6456 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MATR3 antibody, catalog no. 70R-1389

Matrin 3 Conjugated Antibody

C49779 100ul
EUR 397

Human Zinc finger matrin-type protein 3 (ZMAT3) ELISA Kit

abx251106-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ZMAT3/ Zinc finger matrin-type protein 3 ELISA Kit

E2721Hu 1 Kit
EUR 571

Human ZMAT3(Zinc finger matrin-type protein 3) ELISA Kit

EH1798 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9HA38
  • Alias: ZMAT3/Zinc finger matrin-type protein 3/Zinc finger protein WIG-1/p53-activated gene 608 protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Zinc finger matrin- type protein 3, ZMAT3 ELISA KIT

ELI-05061h 96 Tests
EUR 824

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

MATR3 antibody

70R-18424 50 ul
EUR 435
Description: Rabbit polyclonal MATR3 antibody

MATR3 Antibody

36602-100ul 100ul
EUR 252

MATR3 antibody

10R-1442 50 ug
EUR 242
Description: Mouse monoclonal MATR3 antibody

MATR3 antibody

10R-10395 100 ug
EUR 435
Description: Mouse monoclonal MATR3 antibody

MATR3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

MATR3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

MATR3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human MATR3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MATR3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1273604 1.0 ug DNA
EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2822504 1.0 ug DNA
EUR 154

Bovine Zinc finger matrin- type protein 3, ZMAT3 ELISA KIT

ELI-05062b 96 Tests
EUR 928

Mouse Zinc finger matrin- type protein 3, Zmat3 ELISA KIT

ELI-05063m 96 Tests
EUR 865

Cow Zinc finger matrin-type protein 3 (ZMAT3) ELISA Kit

abx517721-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Zinc finger matrin-type protein 3 (ZMAT3) ELISA Kit

abx517723-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Zinc finger matrin-type protein 3 (ZMAT3) ELISA Kit

abx517724-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Zinc Finger, Matrin-Type 3 Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 0.1 mg
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

MATR3 Conjugated Antibody

C36602 100ul
EUR 397

MATR3 cloning plasmid

CSB-CL013525HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2544
  • Sequence: atgtccaagtcattccagcagtcatctctcagtagggactcacagggtcatgggcgtgacctgtctgcggcaggaataggccttcttgctgctgctacccagtctttaagtatgccagcatctcttggaaggatgaaccagggtactgcacgccttgctagtttaatgaatcttg
  • Show more
Description: A cloning plasmid for the MATR3 gene.

MATR3 Rabbit pAb

A5905-100ul 100 ul
EUR 308

MATR3 Rabbit pAb

A5905-200ul 200 ul
EUR 459

MATR3 Rabbit pAb

A5905-20ul 20 ul
EUR 183

MATR3 Rabbit pAb

A5905-50ul 50 ul
EUR 223

MATR3 Polyclonal Antibody

ABP59230-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MATR3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MATR3 from Human. This MATR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATR3 protein

MATR3 Polyclonal Antibody

ABP59230-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MATR3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MATR3 from Human. This MATR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATR3 protein

MATR3 Polyclonal Antibody

ABP59230-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MATR3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MATR3 from Human. This MATR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATR3 protein

anti- MATR3 antibody

FNab05030 100µg
EUR 548.75
  • Immunogen: matrin 3
  • Uniprot ID: P43243
  • Gene ID: 9782
  • Research Area: Neuroscience
Description: Antibody raised against MATR3

MATR3 Polyclonal Antibody

ES11773-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MATR3. This antibody is tested and validated for WB, ELISA, WB, ELISA

MATR3 Polyclonal Antibody

ES11773-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MATR3. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MATR3 antibody

PAab05030 100 ug
EUR 386


PVT13174 2 ug
EUR 391

Anti-MATR3 antibody

STJ117820 100 µl
EUR 277
Description: This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X.

Anti-MATR3 antibody

STJ192931 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MATR3

FSH (Human Follicle-stimulating hormone) ELISA test

3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

MATR3 ORF Vector (Human) (pORF)

ORF006294 1.0 ug DNA
EUR 95

Human Zinc finger matrin- type protein 5, ZMAT5 ELISA KIT

ELI-17883h 96 Tests
EUR 824

Human Zinc finger matrin- type protein 1, ZMAT1 ELISA KIT

ELI-17996h 96 Tests
EUR 824

Human Zinc finger matrin- type protein 4, ZMAT4 ELISA KIT

ELI-22603h 96 Tests
EUR 824

Human Zinc finger matrin- type protein 2, ZMAT2 ELISA KIT

ELI-28329h 96 Tests
EUR 824

Human Zinc finger matrin-type protein 2 (ZMAT2) ELISA Kit

abx384409-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Zinc Finger, Matrin Type 3 (ZMAT3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ZMAT3 Zinc Finger, Matrin-Type 3 Human Recombinant Protein

PROTQ9HA38 Regular: 10ug
EUR 317
Description: ZMAT3 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 312 amino acids (1-289) and having a molecular mass of 34.4kDa.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Matr3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6863004 1.0 ug DNA
EUR 154

Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4726504 1.0 ug DNA
EUR 154

Matr3 3'UTR Luciferase Stable Cell Line

TU112946 1.0 ml Ask for price

Matr3 3'UTR GFP Stable Cell Line

TU162946 1.0 ml Ask for price

Matr3 3'UTR Luciferase Stable Cell Line

TU212912 1.0 ml Ask for price

Matr3 3'UTR GFP Stable Cell Line

TU262912 1.0 ml Ask for price

MATR3 3'UTR GFP Stable Cell Line

TU063055 1.0 ml
EUR 1521

MATR3 3'UTR Luciferase Stable Cell Line

TU013055 1.0 ml
EUR 1521

Rat MATR3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MATR3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Dr. P Kit-Solution 3

K2021010-3 50 ml
EUR 133
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

MATR3 sgRNA CRISPR Lentivector set (Human)

K1273601 3 x 1.0 ug
EUR 339

MATR3 sgRNA CRISPR Lentivector set (Human)

K2822501 3 x 1.0 ug
EUR 339

Recombinant Human MMP-3 Protein

PROTP08254-3 10ug
EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-3 degrades fibronectin, laminin, collagens III, IV, and X, and cartilage proteoglycans. Recombinant human MMP-3 is a 42.8 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (378 amino acids).

IL-3 Interleukin-3 Human Recombinant Protein, His Tag

PROTP08700-3 Regular: 50ug
EUR 317
Description: Interleukin-3 Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 154 amino acids fragment (20-152) and having a total molecular mass of 17.3kDa and fused with a 20 aa N-terminal His tag. ;The IL3 His is purified by proprietary chromatographic techniques.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc finger matrin-type protein 3 (ZMAT3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody

abx036149-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody

abx239648-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Zinc finger matrin-type protein 3 (ZMAT3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit

DLR-CA15-3-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 15-3 (CA15-3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit

DLR-CA15-3-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 15-3 (CA15-3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit

RDR-CA15-3-Hu-48Tests 48 Tests
EUR 500

Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit

RDR-CA15-3-Hu-96Tests 96 Tests
EUR 692

Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit

RD-CA15-3-Hu-48Tests 48 Tests
EUR 478

Human Carbohydrate Antigen 15-3 (CA15-3) ELISA Kit

RD-CA15-3-Hu-96Tests 96 Tests
EUR 662

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Mouse Zinc finger matrin- type protein 2, Zmat2 ELISA KIT

ELI-28646m 96 Tests
EUR 865

Mouse Zinc finger matrin- type protein 4, Zmat4 ELISA KIT

ELI-28647m 96 Tests
EUR 865

Bovine Zinc finger matrin- type protein 5, ZMAT5 ELISA KIT

ELI-51251b 96 Tests
EUR 928

Mouse Zinc finger matrin- type protein 1, Zmat1 ELISA KIT

ELI-40474m 96 Tests
EUR 865

Bovine Zinc finger matrin- type protein 4, ZMAT4 ELISA KIT

ELI-40655b 96 Tests
EUR 928

Mouse Zinc finger matrin- type protein 5, Zmat5 ELISA KIT

ELI-40702m 96 Tests
EUR 865

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Caspase-3 DEVD-R110 Fluorometric HTS Assay Kit

30009-3 1KIT
EUR 809
Description: Minimum order quantity: 1 unit of 1KIT

Matr3 ORF Vector (Rat) (pORF)

ORF070324 1.0 ug DNA
EUR 506

Matr3 ORF Vector (Mouse) (pORF)

ORF049866 1.0 ug DNA
EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

MATR3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1273602 1.0 ug DNA
EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1273603 1.0 ug DNA
EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2822502 1.0 ug DNA
EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2822503 1.0 ug DNA
EUR 154

MATR3 Protein Vector (Human) (pPB-C-His)

PV025173 500 ng
EUR 329

MATR3 Protein Vector (Human) (pPB-N-His)

PV025174 500 ng
EUR 329

MATR3 Protein Vector (Human) (pPM-C-HA)

PV025175 500 ng
EUR 329

MATR3 Protein Vector (Human) (pPM-C-His)

PV025176 500 ng
EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

TGF-b-3 Transforming Growth Factor-Beta 3 Human Recombinant Protein, Plant

PROTP10600-3 Regular: 5ug
EUR 317
Description: TGFB3 Human Recombinant produced in plant is a disulfide-linked homodimeric, glycosylated, polypeptide chain containing 118 amino acids and having a molecular mass of 27.2kDa. ;The TGFB3 is fused to 6xHis tag at N-terminus and purified by standard chromatographic techniques.

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

PLGF3 Human, Placenta Growth Factor-3 Human Recombinant Protein, sf9

PROTP49763-3 Regular: 25ug
EUR 317
Description: PLGF3 Human Recombinant produced in Spodoptera frugiperda is a glycosylated homodimer containing 2 chains of 203 amino acids (Leu19-Arg221) and having a molecular mass of 58kDa.;The PLGF-3 is purified by proprietary chromatographic techniques.

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

MATR3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1273608 1.0 ug DNA
EUR 167

MATR3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2822508 1.0 ug DNA
EUR 167

Human Zinc finger matrin-type protein 5 (ZMAT5)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Zinc finger matrin-type protein 5(ZMAT5) expressed in E.coli

Human Zinc finger matrin-type protein 2 (ZMAT2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Zinc finger matrin-type protein 2(ZMAT2),partial expressed in E.coli

ANGPTL3 (17-460)Human Angiopoietin-like Protein 3 (17-460 a.a.) Human Recombinant Protein

PROTQ9Y5C1-3 Regular: 10ug
EUR 317
Description: ANGPTL3 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 453 amino acids (17-460 a.a.) and having a molecular mass of 52.9kDa (Migrates at 25-70kDa on SDS-PAGE under reducing conditions). 

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Matr3 sgRNA CRISPR Lentivector set (Rat)

K6863001 3 x 1.0 ug
EUR 339

Matr3 sgRNA CRISPR Lentivector set (Mouse)

K4726501 3 x 1.0 ug
EUR 339

Anti-14-3-3 alpha + beta Rabbit Monoclonal Antibody

M02431-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal 14-3-3 alpha + beta Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Mouse anti-dsDNA IgG3-specific ELISA Kit, 96 tests, Quantitative

5120-3 1 kit
EUR 712

Individual Reaction Mix 3

G065-3 200 reactions
EUR 167

3-D Life Thioglycerol

T10-3 180 µl
EUR 48

Western Blot Box - 2 7/8 x 1 3/16 x 3/4in.; 7.3 x 3 x 1.9cm

B1200-3 5/pack
EUR 63.77
Description: Western Blot Boxes

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

3-D Life PEG-Link

L50-3 3x 200 µl
EUR 94

3-D Life CD-Link

L60-3 3 x 200 µl
EUR 321

3-D-Life SG-PVA

M81-3 3x 170 µl
EUR 148

3-D Life FG-PVA

M82-3 3x 170 µl
EUR 148

3-D Life SG-Dextran

M91-3 3x 170 µl
EUR 157

3-D Life FG-Dextran

M92-3 3x 170 µl
EUR 157

3-D Life RGD Peptide

P10-3 3x 1 µmol
EUR 276

pLenti-CARM1 shRNA-3 Plasmid

PVTBAV03691-3 2 ug
EUR 356

pLenti-CTLA4 shRNA-3 Plasmid

PVTBAV05689-3 2 ug
EUR 356

pLenti-FOXM1 shRNA-3 Plasmid

PVTBAV08732-3 2 ug
EUR 356

pLenti-JUN shRNA-3 Plasmid

PVTBAV11741-3 2 ug
EUR 356

pLenti-LHX6 shRNA-3 Plasmid

PVTBAV12881-3 2 ug
EUR 356

pLenti-MAGEA3 shRNA-3 Plasmid

PVTBAV13661-3 2 ug
EUR 356

pLenti-RUNX3 shRNA-3 Plasmid

PVTBAV20583-3 2 ug
EUR 356

pLenti-Slc7a11 shRNA-3 Plasmid

PVTBAV21973-3 2 ug
EUR 356

pLenti-STAT3 shRNA-3 Plasmid

PVTBAV22921-3 2 ug
EUR 356

Caspase-3 Inhibitor Q-DEVD-OPh

EUR 533

Anti-VEGF Receptor 3/FLT4 Antibody

A01276-3 100ug/vial
EUR 334

3-D Life Scrambled RGD Peptide

P11-3 3x 1 µmol
EUR 276

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human MATR3(Matrin 3) ELISA Kit