Human LEPREL1(Leprecan Like Protein 1) ELISA Kit
Human LEPREL1(Leprecan Like Protein 1) ELISA Kit
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
DLR-LEPREL1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
RDR-LEPREL1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
RDR-LEPREL1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
RD-LEPREL1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
RD-LEPREL1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Leprecan Like Protein 1 (LEPREL1)ELISA Kit |
201-12-2787 |
SunredBio |
96 tests |
EUR 440 |
- This Leprecan Like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
20-abx152191 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
SEH747Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
SEH747Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
SEH747Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
SEH747Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit |
4-SEH747Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Leprecan Like Protein 1 elisa. Alternative names of the recognized antigen: MLAT4
- P3H2
- Prolyl 3-Hydroxylase 2
- Myxoid liposarcoma-associated protein 4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Leprecan-Like 1 (LEPREL1) Antibody |
20-abx113460 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Leprecan Like Protein 1 (LEPREL1) Antibody |
20-abx177322 |
Abbexa |
|
|
|
Leprecan Like Protein 1 (LEPREL1) Antibody |
20-abx173324 |
Abbexa |
|
|
|
Human Leprecan Like Protein 1 (LEPREL1) Protein |
20-abx654158 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Leprecan Like Protein 1 (LEPREL1) CLIA Kit |
20-abx495529 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human LEPREL1 (Leprecan Like Protein 1) |
ELK4246 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Leprecan Like Protein 1 (LEPREL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Leprecan Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Leprecan-Like 2 (LEPREL2) Antibody |
20-abx113461 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Leprecan-1 (LEPRE1) Antibody |
20-abx126089 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
LEPREL1 (LEPREL1) Antibody |
20-abx007118 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
LEPREL1 (LEPREL1) Antibody |
abx036203-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
LEPREL1 (LEPREL1) Antibody |
abx234752-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
LEPREL1 ELISA Kit (Human) (OKCD09090) |
OKCD09090 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL |
LEPREL1 ELISA Kit (Human) (OKDD00376) |
OKDD00376 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL |
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit |
EI1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
LEPREL1 antibody |
70R-18252 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LEPREL1 antibody |
LEPREL1 Antibody |
39880-100ul |
SAB |
100ul |
EUR 390 |
LEPREL1 antibody |
70R-35573 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Purified Rabbit polyclonal LEPREL1 antibody |
LEPREL1 Antibody |
1-CSB-PA012873GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against LEPREL1. Recognizes LEPREL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
LEPREL1 siRNA |
20-abx902955 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LEPREL1 siRNA |
20-abx922439 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LEPREL1 siRNA |
20-abx922440 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VSNL1 Visinin-Like Protein-1 Human Recombinant Protein |
PROTP62760-1 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: VSNL1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 191 amino acids (1-191 a.a.) and having a molecular mass of 22.1kDa.;The VSNL1 is purified by proprietary chromatographic techniques. |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Human LEPREL1 shRNA Plasmid |
20-abx960563 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Human Prolyl 3- hydroxylase 2, LEPREL1 ELISA KIT |
ELI-46600h |
Lifescience Market |
96 Tests |
EUR 824 |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
DLK1 Human, Delta-Like 1 Human Recombinant Protein, HEK |
PROTP80370-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: DLK1 Human Recombinant produced in HEK293 Cells is a single, glycosylated, polypeptide chain (a.a 24-303) containing 290 amino acids including a 10 a.a C-terminal His tag. The total molecular mass is 31.2kDa (calculated).  |
FSTL1 Human, Follistatin Like 1 Human Recombinant Protein, HEK |
PROTQ12841-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: FSTL1 Human Recombinant produced in HEK293 cells is a single, glycosylated polypeptide chain (a.a 21-308) containing 296 amino acids including a 8 a.a C-terminal His tag. The total molecular mass is 33.8kDa (calculated). |
IL1RL1 Human, Interleukin-1 Receptor Like-1 Human Recombinant Protein, Sf9 |
PROTQ01638-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: IL 1RL1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (19-328 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 318 amino acids and having a molecular mass of 36.0kDa.;IL 1RL1 shows multiple bands between 40-57kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques. |
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit |
EMI1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
LEPREL1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1208502 |
ABM |
1.0 ug DNA |
EUR 154 |
LEPREL1 Polyclonal Antibody |
31430-100ul |
SAB |
100ul |
EUR 252 |
LEPREL1 Polyclonal Antibody |
31430-50ul |
SAB |
50ul |
EUR 187 |
LEPREL1 cloning plasmid |
CSB-CL815555HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1584
- Sequence: atggaaatgcagcagaacattgagaattacagggcgacagctggtgttgaagcattgcagttggtagacagagaagccaagccacacatggagagttacaatgcaggagttaaacattatgaggctgatgactttgagatggctatcaggcatttcgaacaagccttaagagaat
- Show more
|
Description: A cloning plasmid for the LEPREL1 gene. |
LEPREL1 Rabbit pAb |
A8068-100ul |
Abclonal |
100 ul |
EUR 308 |
LEPREL1 Rabbit pAb |
A8068-200ul |
Abclonal |
200 ul |
EUR 459 |
LEPREL1 Rabbit pAb |
A8068-20ul |
Abclonal |
20 ul |
EUR 183 |
LEPREL1 Rabbit pAb |
A8068-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- LEPREL1 antibody |
FNab04752 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: leprecan-like 1
- Uniprot ID: Q8IVL5
- Research Area: Signal Transduction, Neuroscience
|
Description: Antibody raised against LEPREL1 |
Anti-LEPREL1 antibody |
STJ110371 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
GLP-1 Glucagon Like Peptide-1 (31 a.a.) Human Recombinant Protein |
PROTP01275-1 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: Glucagon Like Peptide-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 31 amino acids and having a molecular mass of 3298.7 Dalton. The GLP-1 is purified by proprietary chromatographic techniques. |
ELISA kit for Human Prolyl 3-hydroxylase 2 (LEPREL1) |
KTE61831-48T |
Abbkine |
48T |
EUR 332 |
- LEPREL1 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly. The deduced 708-amino acid protein has an N-terminal signal peptide, 4 tetratricopeptide repeats, 4 CxxxC motifs, a central
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prolyl 3-hydroxylase 2 (LEPREL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Prolyl 3-hydroxylase 2 (LEPREL1) |
KTE61831-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- LEPREL1 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly. The deduced 708-amino acid protein has an N-terminal signal peptide, 4 tetratricopeptide repeats, 4 CxxxC motifs, a central
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prolyl 3-hydroxylase 2 (LEPREL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Prolyl 3-hydroxylase 2 (LEPREL1) |
KTE61831-96T |
Abbkine |
96T |
EUR 539 |
- LEPREL1 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly. The deduced 708-amino acid protein has an N-terminal signal peptide, 4 tetratricopeptide repeats, 4 CxxxC motifs, a central
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prolyl 3-hydroxylase 2 (LEPREL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
TINAGL1 Human, Tubulointerstitial Nephritis Antigen Like 1 Human Recombinant Protein, Sf9 |
PROTQ9GZM7-1 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: TINAGL1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 455 amino acids (22-467a.a.) and having a molecular mass of 51.2kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TINAGL1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
LEPREL1 ORF Vector (Human) (pORF) |
ORF005897 |
ABM |
1.0 ug DNA |
EUR 95 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Anti-Vangl1/Vang Like Protein 1 Antibody |
A07587-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for Vangl1 Antibody (VANGL1) detection. Tested with WB in Human, Mouse. |
Anti-Visinin-like Protein 1 Monoclonal Antibody |
M06959-1 |
BosterBio |
100ul |
EUR 397 |
Description: Mouse Monoclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat. |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
LEPREL1 Protein Vector (Human) (pPB-C-His) |
PV023585 |
ABM |
500 ng |
EUR 329 |
LEPREL1 Protein Vector (Human) (pPB-N-His) |
PV023586 |
ABM |
500 ng |
EUR 329 |
LEPREL1 Protein Vector (Human) (pPM-C-HA) |
PV023587 |
ABM |
500 ng |
EUR 329 |
LEPREL1 Protein Vector (Human) (pPM-C-His) |
PV023588 |
ABM |
500 ng |
EUR 329 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Chicken Prolyl 3- hydroxylase 2, LEPREL1 ELISA KIT |
ELI-35731c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Prolyl 3- hydroxylase 2, Leprel1 ELISA KIT |
ELI-35732m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Fibrinogen Like Protein 1 ELISA kit |
E01F0080-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Fibrinogen Like Protein 1 ELISA kit |
E01F0080-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Fibrinogen Like Protein 1 ELISA kit |
E01F0080-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Follistatin Like Protein 1 ELISA kit |
E01F0385-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Follistatin Like Protein 1 ELISA kit |
E01F0385-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Follistatin Like Protein 1 ELISA kit |
E01F0385-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tolloid Like Protein 1 ELISA kit |
E01T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tolloid Like Protein 1 ELISA kit |
E01T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tolloid Like Protein 1 ELISA kit |
E01T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Angiopoietin Like Protein 1 ELISA kit |
E01A0504-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Angiopoietin Like Protein 1 ELISA kit |
E01A0504-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human LEPREL1(Leprecan Like Protein 1) ELISA Kit