Human LEPREL1(Leprecan Like Protein 1) ELISA Kit

Human LEPREL1(Leprecan Like Protein 1) ELISA Kit

To Order: Contact us

Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
DLR-LEPREL1-Hu-96T 96T
EUR 673
  • Should the Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
RDR-LEPREL1-Hu-48Tests 48 Tests
EUR 544
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
RDR-LEPREL1-Hu-96Tests 96 Tests
EUR 756
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
RD-LEPREL1-Hu-48Tests 48 Tests
EUR 521
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
RD-LEPREL1-Hu-96Tests 96 Tests
EUR 723
Human Leprecan Like Protein 1 (LEPREL1)ELISA Kit
201-12-2787 96 tests
EUR 440
  • This Leprecan Like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
20-abx152191
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Leprecan Like Protein 1(LEPREL1)ELISA Kit
QY-E01994 96T
EUR 361
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
SEH747Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
SEH747Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
SEH747Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
SEH747Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
4-SEH747Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Leprecan Like Protein 1 elisa. Alternative names of the recognized antigen: MLAT4
  • P3H2
  • Prolyl 3-Hydroxylase 2
  • Myxoid liposarcoma-associated protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Leprecan-Like 1 (LEPREL1) Antibody
20-abx113460
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Leprecan Like Protein 1 (LEPREL1) Antibody
20-abx177322
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Leprecan Like Protein 1 (LEPREL1) Antibody
20-abx173324
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Human Leprecan Like Protein 1 (LEPREL1) Protein
20-abx654158
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Leprecan Like Protein 1 (LEPREL1) CLIA Kit
20-abx495529
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human LEPREL1 (Leprecan Like Protein 1)
ELK4246 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Leprecan Like Protein 1 (LEPREL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Leprecan Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Leprel1/ Rat Leprel1 ELISA Kit
ELI-23285r 96 Tests
EUR 886
Leprecan-Like 2 (LEPREL2) Antibody
20-abx113461
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
LEPREL1 ELISA KIT|Human
EF010657 96 Tests
EUR 689
Leprecan-1 (LEPRE1) Antibody
20-abx126089
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
LEPREL1 (LEPREL1) Antibody
20-abx007118
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
LEPREL1 (LEPREL1) Antibody
abx036203-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
LEPREL1 (LEPREL1) Antibody
abx234752-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
LEPREL1 ELISA Kit (Human) (OKCD09090)
OKCD09090 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL
LEPREL1 ELISA Kit (Human) (OKDD00376)
OKDD00376 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1 96 Well Plate
EUR 477
LEPREL1 antibody
70R-18252 50 ul
EUR 435
Description: Rabbit polyclonal LEPREL1 antibody
LEPREL1 Antibody
39880-100ul 100ul
EUR 390
LEPREL1 antibody
70R-35573 100 ug
EUR 349
Description: Purified Rabbit polyclonal LEPREL1 antibody
LEPREL1 Antibody
1-CSB-PA012873GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LEPREL1. Recognizes LEPREL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
LEPREL1 siRNA
20-abx902955
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LEPREL1 siRNA
20-abx922439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LEPREL1 siRNA
20-abx922440
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VSNL1 Visinin-Like Protein-1 Human Recombinant Protein
PROTP62760-1 Regular: 50ug
EUR 317
Description: VSNL1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 191 amino acids (1-191 a.a.) and having a molecular mass of 22.1kDa.;The VSNL1 is purified by proprietary chromatographic techniques.
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
Human LEPREL1 shRNA Plasmid
20-abx960563
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
Human Prolyl 3- hydroxylase 2, LEPREL1 ELISA KIT
ELI-46600h 96 Tests
EUR 824
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
DLK1 Human, Delta-Like 1 Human Recombinant Protein, HEK
PROTP80370-1 Regular: 10ug
EUR 317
Description: DLK1 Human Recombinant produced in HEK293 Cells is a single, glycosylated, polypeptide chain (a.a 24-303) containing 290 amino acids including a 10 a.a C-terminal His tag. The total molecular mass is 31.2kDa (calculated). 
FSTL1 Human, Follistatin Like 1 Human Recombinant Protein, HEK
PROTQ12841-1 Regular: 10ug
EUR 317
Description: FSTL1 Human Recombinant produced in HEK293 cells is a single, glycosylated polypeptide chain (a.a 21-308) containing 296 amino acids including a 8 a.a C-terminal His tag. The total molecular mass is 33.8kDa (calculated).
IL1RL1 Human, Interleukin-1 Receptor Like-1 Human Recombinant Protein, Sf9
PROTQ01638-1 Regular: 10ug
EUR 317
Description: IL 1RL1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (19-328 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 318 amino acids and having a molecular mass of 36.0kDa.;IL 1RL1 shows multiple bands between 40-57kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EMI1001-1 96 Well Plate
EUR 477
LEPREL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1208502 1.0 ug DNA
EUR 154
LEPREL1 Polyclonal Antibody
31430-100ul 100ul
EUR 252
LEPREL1 Polyclonal Antibody
31430-50ul 50ul
EUR 187
LEPREL1 cloning plasmid
CSB-CL815555HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: atggaaatgcagcagaacattgagaattacagggcgacagctggtgttgaagcattgcagttggtagacagagaagccaagccacacatggagagttacaatgcaggagttaaacattatgaggctgatgactttgagatggctatcaggcatttcgaacaagccttaagagaat
  • Show more
Description: A cloning plasmid for the LEPREL1 gene.
LEPREL1 Rabbit pAb
A8068-100ul 100 ul
EUR 308
LEPREL1 Rabbit pAb
A8068-200ul 200 ul
EUR 459
LEPREL1 Rabbit pAb
A8068-20ul 20 ul
EUR 183
LEPREL1 Rabbit pAb
A8068-50ul 50 ul
EUR 223
anti- LEPREL1 antibody
FNab04752 100µg
EUR 548.75
  • Immunogen: leprecan-like 1
  • Uniprot ID: Q8IVL5
  • Research Area: Signal Transduction, Neuroscience
Description: Antibody raised against LEPREL1
Anti-LEPREL1 antibody
PAab04752 100 ug
EUR 386
Anti-LEPREL1 antibody
STJ110371 100 µl
EUR 277
Description: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
GLP-1 Glucagon Like Peptide-1 (31 a.a.) Human Recombinant Protein
PROTP01275-1 Regular: 50ug
EUR 317
Description: Glucagon Like Peptide-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 31 amino acids and having a molecular mass of 3298.7 Dalton. The GLP-1 is purified by proprietary chromatographic techniques.
ELISA kit for Human Prolyl 3-hydroxylase 2 (LEPREL1)
KTE61831-48T 48T
EUR 332
  • LEPREL1 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly. The deduced 708-amino acid protein has an N-terminal signal peptide, 4 tetratricopeptide repeats, 4 CxxxC motifs, a central
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl 3-hydroxylase 2 (LEPREL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Prolyl 3-hydroxylase 2 (LEPREL1)
KTE61831-5platesof96wells 5 plates of 96 wells
EUR 2115
  • LEPREL1 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly. The deduced 708-amino acid protein has an N-terminal signal peptide, 4 tetratricopeptide repeats, 4 CxxxC motifs, a central
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl 3-hydroxylase 2 (LEPREL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Prolyl 3-hydroxylase 2 (LEPREL1)
KTE61831-96T 96T
EUR 539
  • LEPREL1 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly. The deduced 708-amino acid protein has an N-terminal signal peptide, 4 tetratricopeptide repeats, 4 CxxxC motifs, a central
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl 3-hydroxylase 2 (LEPREL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
TINAGL1 Human, Tubulointerstitial Nephritis Antigen Like 1 Human Recombinant Protein, Sf9
PROTQ9GZM7-1 Regular: 5ug
EUR 317
Description: TINAGL1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 455 amino acids (22-467a.a.) and having a molecular mass of 51.2kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TINAGL1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
LEPREL1 ORF Vector (Human) (pORF)
ORF005897 1.0 ug DNA
EUR 95
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Anti-Vangl1/Vang Like Protein 1 Antibody
A07587-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Vangl1 Antibody (VANGL1) detection. Tested with WB in Human, Mouse.
Anti-Visinin-like Protein 1 Monoclonal Antibody
M06959-1 100ul
EUR 397
Description: Mouse Monoclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
LEPREL1 Protein Vector (Human) (pPB-C-His)
PV023585 500 ng
EUR 329
LEPREL1 Protein Vector (Human) (pPB-N-His)
PV023586 500 ng
EUR 329
LEPREL1 Protein Vector (Human) (pPM-C-HA)
PV023587 500 ng
EUR 329
LEPREL1 Protein Vector (Human) (pPM-C-His)
PV023588 500 ng
EUR 329
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1 96 Well Plate
EUR 477
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
Chicken Prolyl 3- hydroxylase 2, LEPREL1 ELISA KIT
ELI-35731c 96 Tests
EUR 928
Mouse Prolyl 3- hydroxylase 2, Leprel1 ELISA KIT
ELI-35732m 96 Tests
EUR 865
Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Follistatin Like Protein 1 ELISA kit
E01F0385-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Follistatin Like Protein 1 ELISA kit
E01F0385-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Follistatin Like Protein 1 ELISA kit
E01F0385-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tolloid Like Protein 1 ELISA kit
E01T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tolloid Like Protein 1 ELISA kit
E01T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tolloid Like Protein 1 ELISA kit
E01T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human LEPREL1(Leprecan Like Protein 1) ELISA Kit

Copyright 2020. All Rights reserved.
Made with by WPlook Themes