Human KYNU(Kynureninase) ELISA Kit
Human KYNU(Kynureninase) ELISA Kit
Human Kynureninase (KYNU) ELISA Kit |
DLR-KYNU-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Kynureninase (KYNU) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Kynureninase (KYNU) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Kynureninase (KYNU) ELISA Kit |
RDR-KYNU-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Kynureninase (KYNU) ELISA Kit |
RDR-KYNU-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Kynureninase (KYNU) ELISA Kit |
RD-KYNU-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Kynureninase (KYNU) ELISA Kit |
RD-KYNU-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Kynureninase (KYNU) |
1-CSB-EP621970HU(F2) |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 61.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Kynureninase(KYNU) expressed in E.coli |
Human Kynureninase (KYNU) ELISA Kit |
20-abx152144 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human KYNU/ Kynureninase ELISA Kit |
E1412Hu |
Sunlong |
1 Kit |
EUR 605 |
Human KYNU(Kynureninase) ELISA Kit |
EH1193 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q16719
- Alias: KYNU/kynureninase/L-kynurenine hydrolase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Kynureninase (KYNU) ELISA Kit |
abx571684-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Kynureninase ELISA Kit (KYNU) |
RK01751 |
Abclonal |
96 Tests |
EUR 521 |
Human Kynureninase (KYNU) ELISA Kit |
SED762Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids. |
Human Kynureninase (KYNU) ELISA Kit |
SED762Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids. |
Human Kynureninase (KYNU) ELISA Kit |
SED762Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids. |
Human Kynureninase (KYNU) ELISA Kit |
SED762Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids. |
Human Kynureninase (KYNU) ELISA Kit |
4-SED762Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Kynureninase elisa. Alternative names of the recognized antigen: L-Kynurenine Hydrolase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kynureninase (KYNU) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Kynureninase (KYNU) Antibody |
20-abx005092 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Kynureninase (KYNU) Antibody |
20-abx177286 |
Abbexa |
|
|
|
Kynureninase (KYNU) Antibody |
20-abx113415 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kynureninase (KYNU) Antibody |
abx122988-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Kynureninase (KYNU) Antibody |
20-abx141362 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Kynureninase (KYNU) Antibody |
20-abx173278 |
Abbexa |
|
|
|
Kynureninase (KYNU) Antibody |
20-abx321389 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kynureninase (KYNU) Antibody |
20-abx321390 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Kynureninase (KYNU) Antibody |
abx234667-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Kynureninase (KYNU) Antibody |
20-abx317866 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Kynu/ Kynureninase ELISA Kit |
E0844Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Kynureninase (KYNU) ELISA Kit |
abx514933-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Kynureninase (KYNU) ELISA Kit |
abx514934-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Human KYNU (Kynureninase) |
ELK4508 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kynureninase (KYNU). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kynureninase (
- Show more
|
Description: A sandwich ELISA kit for detection of Kynureninase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Kynureninase (KYNU) Protein |
20-abx654132 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Kynureninase (KYNU) CLIA Kit |
20-abx494378 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Kynureninase (KYNU) Antibody (HRP) |
20-abx313375 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Kynureninase (KYNU) Antibody (FITC) |
20-abx313376 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Kynureninase (KYNU) Antibody (Biotin) |
20-abx313377 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Human Kynureninase |
EK2659 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kynureninase in samples from serum, plasma, tissue homogenates and other biological fluids. |
KYNU ELISA Kit (Human) (OKAN05641) |
OKAN05641 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL |
KYNU ELISA Kit (Human) (OKCD08531) |
OKCD08531 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway.Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Two transcript variants encoding different isoforms have been found for this gene.Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL |
KYNU ELISA Kit (Human) (OKEH02100) |
OKEH02100 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL |
ELISA kit for Rat Kynureninase |
EK2660 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Kynureninase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Kynureninase, CF |
PR15077CF |
Neuromics |
10 ug |
EUR 435 |
KYNU ELISA Kit (Rat) (OKEH03595) |
OKEH03595 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Catalyzes the cleavage of L-kynurenine (L-Kyn) and L-3-hydroxykynurenine (L-3OHKyn) into anthranilic acid (AA) and 3-hydroxyanthranilic acid (3-OHAA), respectively. Has a preference for the L-3-hydroxy form. Also has cysteine-conjugate-beta-lyase activity.UniRule annotation;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.159 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
KYNU antibody |
22336-100ul |
SAB |
100ul |
EUR 390 |
KYNU antibody |
70R-18198 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal KYNU antibody |
KYNU antibody |
70R-1261 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal KYNU antibody |
KYNU antibody |
70R-13640 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal KYNU antibody |
KYNU antibody |
39066-100ul |
SAB |
100ul |
EUR 252 |
KYNU Antibody |
43079-100ul |
SAB |
100ul |
EUR 252 |
KYNU Antibody |
1-CSB-PA621970ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000 |
KYNU Antibody |
1-CSB-PA621970ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000 |
KYNU Antibody |
1-CSB-PA621970LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
KYNU antibody |
70R-3487 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal KYNU antibody |
KYNU Antibody |
1-CSB-PA012703GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
KYNU siRNA |
20-abx902918 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KYNU siRNA |
20-abx922176 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KYNU siRNA |
20-abx922177 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human KYNU shRNA Plasmid |
20-abx955915 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KYNU Recombinant Protein (Human) |
RP017440 |
ABM |
100 ug |
Ask for price |
KYNU Blocking Peptide |
33R-4774 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KYNU antibody, catalog no. 70R-3487 |
KYNU Blocking Peptide |
33R-5947 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KYNU antibody, catalog no. 70R-1261 |
KYNU Conjugated Antibody |
C43079 |
SAB |
100ul |
EUR 397 |
KYNU Conjugated Antibody |
C39066 |
SAB |
100ul |
EUR 397 |
KYNU cloning plasmid |
CSB-CL621970HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 924
- Sequence: atggagccttcatctcttgagctgccggctgacacagtgcagcgcattgcggctgaactcaaatgccacccaacggatgagagggtggctctccacctagatgaggaagataagctgaggcacttcagggagtgcttttatattcccaaaatacaggatctgcctccagttgattt
- Show more
|
Description: A cloning plasmid for the KYNU gene. |
KYNU Rabbit pAb |
A6643-100ul |
Abclonal |
100 ul |
EUR 308 |
KYNU Rabbit pAb |
A6643-200ul |
Abclonal |
200 ul |
EUR 459 |
KYNU Rabbit pAb |
A6643-20ul |
Abclonal |
20 ul |
EUR 183 |
KYNU Rabbit pAb |
A6643-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- KYNU antibody |
FNab04667 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: kynureninase (L-kynurenine hydrolase)
- Uniprot ID: Q16719
- Gene ID: 8942
- Research Area: Metabolism
|
Description: Antibody raised against KYNU |
Anti-KYNU antibody |
STJ28726 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants. |
KYNU ORF Vector (Human) (pORF) |
ORF005814 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
KYNU Antibody, HRP conjugated |
1-CSB-PA621970LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
KYNU Antibody, FITC conjugated |
1-CSB-PA621970LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
KYNU Antibody, Biotin conjugated |
1-CSB-PA621970LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mouse KYNU shRNA Plasmid |
20-abx977296 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat KYNU shRNA Plasmid |
20-abx987337 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KYNU Recombinant Protein (Rat) |
RP207719 |
ABM |
100 ug |
Ask for price |
KYNU Recombinant Protein (Mouse) |
RP146726 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
KYNU sgRNA CRISPR Lentivector set (Human) |
K1191501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Kynu ORF Vector (Rat) (pORF) |
ORF069241 |
ABM |
1.0 ug DNA |
EUR 506 |
Kynu ORF Vector (Mouse) (pORF) |
ORF048910 |
ABM |
1.0 ug DNA |
EUR 506 |
KYNU sgRNA CRISPR Lentivector (Human) (Target 1) |
K1191502 |
ABM |
1.0 ug DNA |
EUR 154 |
KYNU sgRNA CRISPR Lentivector (Human) (Target 2) |
K1191503 |
ABM |
1.0 ug DNA |
EUR 154 |
KYNU sgRNA CRISPR Lentivector (Human) (Target 3) |
K1191504 |
ABM |
1.0 ug DNA |
EUR 154 |
KYNU Protein Vector (Human) (pPB-C-His) |
PV023253 |
ABM |
500 ng |
EUR 329 |
KYNU Protein Vector (Human) (pPB-N-His) |
PV023254 |
ABM |
500 ng |
EUR 329 |
KYNU Protein Vector (Human) (pPM-C-HA) |
PV023255 |
ABM |
500 ng |
EUR 329 |
KYNU Protein Vector (Human) (pPM-C-His) |
PV023256 |
ABM |
500 ng |
EUR 329 |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
Human KYNU(Kynureninase) ELISA Kit