Human KYNU(Kynureninase) ELISA Kit

Human KYNU(Kynureninase) ELISA Kit

To Order: Contact us

Human Kynureninase (KYNU) ELISA Kit
DLR-KYNU-Hu-96T	DL Develop	96T	EUR 673
Should the Human Kynureninase (KYNU) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kynureninase (KYNU) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Kynureninase (KYNU) ELISA Kit
RDR-KYNU-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Kynureninase (KYNU) ELISA Kit
RDR-KYNU-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Kynureninase (KYNU) ELISA Kit
RD-KYNU-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Kynureninase (KYNU) ELISA Kit
RD-KYNU-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Kynureninase (KYNU)
1-CSB-EP621970HU(F2)	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 61.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Kynureninase(KYNU) expressed in E.coli

Human Kynureninase (KYNU) ELISA Kit
20-abx152144	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human KYNU/ Kynureninase ELISA Kit
E1412Hu	Sunlong	1 Kit	EUR 605

Human KYNU(Kynureninase) ELISA Kit
EH1193	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q16719 Alias: KYNU/kynureninase/L-kynurenine hydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Kynureninase, KYNU ELISA KIT
ELI-14441h	Lifescience Market	96 Tests	EUR 824

Human Kynureninase (KYNU) ELISA Kit
abx571684-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Kynureninase(KYNU)ELISA Kit
QY-E01800	Qayee Biotechnology	96T	EUR 361

Human Kynureninase ELISA Kit (KYNU)
RK01751	Abclonal	96 Tests	EUR 521

Human Kynureninase (KYNU) ELISA Kit
SED762Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids.

Human Kynureninase (KYNU) ELISA Kit
SED762Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids.

Human Kynureninase (KYNU) ELISA Kit
SED762Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids.

Human Kynureninase (KYNU) ELISA Kit
SED762Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids.

Human Kynureninase (KYNU) ELISA Kit
4-SED762Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kynureninase elisa. Alternative names of the recognized antigen: L-Kynurenine Hydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kynureninase (KYNU) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Kynureninase (KYNU) Antibody
20-abx005092	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Kynureninase (KYNU) Antibody
20-abx177286	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Kynureninase (KYNU) Antibody
20-abx113415	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Kynureninase (KYNU) Antibody
abx122988-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Kynureninase (KYNU) Antibody
20-abx141362	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Kynureninase (KYNU) Antibody
20-abx173278	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Kynureninase (KYNU) Antibody
20-abx321389	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Kynureninase (KYNU) Antibody
20-abx321390	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Kynureninase (KYNU) Antibody
abx234667-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Kynureninase (KYNU) Antibody
20-abx317866	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Kynu/ Kynureninase ELISA Kit
E0844Mo	Sunlong	1 Kit	EUR 632

Mouse Kynureninase, Kynu ELISA KIT
ELI-23328m	Lifescience Market	96 Tests	EUR 865

Mouse Kynureninase (KYNU) ELISA Kit
abx514933-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Kynureninase (KYNU) ELISA Kit
abx514934-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Human KYNU (Kynureninase)
ELK4508	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kynureninase (KYNU). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kynureninase ( Show more
Description: A sandwich ELISA kit for detection of Kynureninase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Kynureninase (KYNU) Protein
20-abx654132	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Kynureninase (KYNU) CLIA Kit
20-abx494378	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Kynureninase (KYNU) Antibody (HRP)
20-abx313375	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kynureninase (KYNU) Antibody (FITC)
20-abx313376	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kynureninase (KYNU) Antibody (Biotin)
20-abx313377	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kynu ELISA Kit| Rat Kynureninase ELISA Kit
EF018890	Lifescience Market	96 Tests	EUR 689

Kynu ELISA Kit| Mouse Kynureninase ELISA Kit
EF015331	Lifescience Market	96 Tests	EUR 689

Kynu/ Rat Kynu ELISA Kit
ELI-47987r	Lifescience Market	96 Tests	EUR 886

ELISA kit for Human Kynureninase
EK2659	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kynureninase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human KYNU ELISA Kit
ELA-E10551h	Lifescience Market	96 Tests	EUR 824

KYNU ELISA KIT|Human
EF002573	Lifescience Market	96 Tests	EUR 689

Human Kynurenine ( KYNU) ELISA Kit
QY-E05349	Qayee Biotechnology	96T	EUR 374

KYNU ELISA Kit (Human) (OKAN05641)
OKAN05641	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL

KYNU ELISA Kit (Human) (OKCD08531)
OKCD08531	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway.Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Two transcript variants encoding different isoforms have been found for this gene.Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL

KYNU ELISA Kit (Human) (OKEH02100)
OKEH02100	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL

ELISA kit for Rat Kynureninase
EK2660	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Kynureninase in samples from serum, plasma, tissue homogenates and other biological fluids.

Kynureninase, CF
PR15077CF	Neuromics	10 ug	EUR 435

KYNU ELISA Kit (Rat) (OKEH03595)
OKEH03595	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Catalyzes the cleavage of L-kynurenine (L-Kyn) and L-3-hydroxykynurenine (L-3OHKyn) into anthranilic acid (AA) and 3-hydroxyanthranilic acid (3-OHAA), respectively. Has a preference for the L-3-hydroxy form. Also has cysteine-conjugate-beta-lyase activity.UniRule annotation;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.159 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

KYNU antibody
22336-100ul	SAB	100ul	EUR 390

KYNU antibody
70R-18198	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal KYNU antibody

KYNU antibody
70R-1261	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal KYNU antibody

KYNU antibody
70R-13640	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal KYNU antibody

KYNU antibody
39066-100ul	SAB	100ul	EUR 252

KYNU Antibody
43079-100ul	SAB	100ul	EUR 252

KYNU Antibody
1-CSB-PA621970ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

KYNU Antibody
1-CSB-PA621970ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

KYNU Antibody
1-CSB-PA621970LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

KYNU antibody
70R-3487	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal KYNU antibody

KYNU Antibody
1-CSB-PA012703GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

KYNU siRNA
20-abx902918	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KYNU siRNA
20-abx922176	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KYNU siRNA
20-abx922177	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human KYNU shRNA Plasmid
20-abx955915	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KYNU Recombinant Protein (Human)
RP017440	ABM	100 ug	Ask for price

KYNU Blocking Peptide
33R-4774	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KYNU antibody, catalog no. 70R-3487

KYNU Blocking Peptide
33R-5947	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KYNU antibody, catalog no. 70R-1261

KYNU Conjugated Antibody
C43079	SAB	100ul	EUR 397

KYNU Conjugated Antibody
C39066	SAB	100ul	EUR 397

KYNU cloning plasmid
CSB-CL621970HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 924 Sequence: atggagccttcatctcttgagctgccggctgacacagtgcagcgcattgcggctgaactcaaatgccacccaacggatgagagggtggctctccacctagatgaggaagataagctgaggcacttcagggagtgcttttatattcccaaaatacaggatctgcctccagttgattt Show more
Description: A cloning plasmid for the KYNU gene.

KYNU Rabbit pAb
A6643-100ul	Abclonal	100 ul	EUR 308

KYNU Rabbit pAb
A6643-200ul	Abclonal	200 ul	EUR 459

KYNU Rabbit pAb
A6643-20ul	Abclonal	20 ul	EUR 183

KYNU Rabbit pAb
A6643-50ul	Abclonal	50 ul	EUR 223

anti- KYNU antibody
FNab04667	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: kynureninase (L-kynurenine hydrolase) Uniprot ID: Q16719 Gene ID: 8942 Research Area: Metabolism
Description: Antibody raised against KYNU

Anti-KYNU antibody
PAab04667	Lifescience Market	100 ug	EUR 355

pCMV-SPORT6-KYNU
PVT12821	Lifescience Market	2 ug	EUR 391

Anti-KYNU antibody
STJ28726	St John's Laboratory	100 µl	EUR 277
Description: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants.

KYNU ORF Vector (Human) (pORF)
ORF005814	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

KYNU Antibody, HRP conjugated
1-CSB-PA621970LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KYNU Antibody, FITC conjugated
1-CSB-PA621970LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KYNU Antibody, Biotin conjugated
1-CSB-PA621970LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse KYNU shRNA Plasmid
20-abx977296	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat KYNU shRNA Plasmid
20-abx987337	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KYNU Recombinant Protein (Rat)
RP207719	ABM	100 ug	Ask for price

KYNU Recombinant Protein (Mouse)
RP146726	ABM	100 ug	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

KYNU sgRNA CRISPR Lentivector set (Human)
K1191501	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Kynu ORF Vector (Rat) (pORF)
ORF069241	ABM	1.0 ug DNA	EUR 506

Kynu ORF Vector (Mouse) (pORF)
ORF048910	ABM	1.0 ug DNA	EUR 506

KYNU sgRNA CRISPR Lentivector (Human) (Target 1)
K1191502	ABM	1.0 ug DNA	EUR 154

KYNU sgRNA CRISPR Lentivector (Human) (Target 2)
K1191503	ABM	1.0 ug DNA	EUR 154

KYNU sgRNA CRISPR Lentivector (Human) (Target 3)
K1191504	ABM	1.0 ug DNA	EUR 154

KYNU Protein Vector (Human) (pPB-C-His)
PV023253	ABM	500 ng	EUR 329

KYNU Protein Vector (Human) (pPB-N-His)
PV023254	ABM	500 ng	EUR 329

KYNU Protein Vector (Human) (pPM-C-HA)
PV023255	ABM	500 ng	EUR 329

KYNU Protein Vector (Human) (pPM-C-His)
PV023256	ABM	500 ng	EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Human KYNU(Kynureninase) ELISA Kit