Human DPEP2(Dipeptidase 2) ELISA Kit
Human DPEP2(Dipeptidase 2) ELISA Kit
Human Dipeptidase 2 (DPEP2) ELISA Kit |
RDR-DPEP2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dipeptidase 2 (DPEP2) ELISA Kit |
RD-DPEP2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dipeptidase 2 (DPEP2) ELISA Kit |
RD-DPEP2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Dipeptidase 2 (DPEP2) ELISA Kit |
20-abx151320 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Dipeptidase 2 (DPEP2) ELISA Kit |
SEF386Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Dipeptidase 2 (DPEP2) ELISA Kit |
SEF386Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Dipeptidase 2 (DPEP2) ELISA Kit |
SEF386Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Dipeptidase 2 (DPEP2) ELISA Kit |
SEF386Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Dipeptidase 2 (DPEP2) ELISA Kit |
4-SEF386Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dipeptidase 2 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidase 2 (DPEP2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Dipeptidase 2 (DPEP2) Antibody |
20-abx124752 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dipeptidase 2 (DPEP2) Antibody |
20-abx130482 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dipeptidase 2 (DPEP2) Antibody |
abx122092-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Dipeptidase 2 (DPEP2) Antibody |
20-abx172127 |
Abbexa |
|
|
|
Dipeptidase 2 (DPEP2) Antibody |
abx232514-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Recombinant Dipeptidase 2 (DPEP2) |
4-RPF386Hu01 |
Cloud-Clone |
-
EUR 350.88
-
EUR 197.00
-
EUR 1040.80
-
EUR 413.60
-
EUR 727.20
-
EUR 298.00
-
EUR 2452.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9H4A9
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Dipeptidase 2 expressed in: E.coli |
ELISA kit for Human DPEP2 (Dipeptidase 2) |
ELK4595 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dipeptidase 2 (DPEP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dipeptidase
- Show more
|
Description: A sandwich ELISA kit for detection of Dipeptidase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Dipeptidase 2 (DPEP2) |
KTE61986-48T |
Abbkine |
48T |
EUR 332 |
- DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathio
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 2 (DPEP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dipeptidase 2 (DPEP2) |
KTE61986-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathio
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 2 (DPEP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dipeptidase 2 (DPEP2) |
KTE61986-96T |
Abbkine |
96T |
EUR 539 |
- DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathio
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 2 (DPEP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Dipeptidase 2 (DPEP2) CLIA Kit |
20-abx494888 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Dipeptidase 2 (DPEP2) Protein |
20-abx650658 |
Abbexa |
-
EUR 495.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 578.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse) |
4-PAF386Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DPEP2 (Leu303~Leu486)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2) |
Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), APC |
4-PAF386Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DPEP2 (Leu303~Leu486)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with APC. |
Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAF386Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DPEP2 (Leu303~Leu486)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with Biotin. |
Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAF386Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DPEP2 (Leu303~Leu486)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with Cy3. |
Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), FITC |
4-PAF386Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DPEP2 (Leu303~Leu486)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with FITC. |
Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), HRP |
4-PAF386Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DPEP2 (Leu303~Leu486)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with HRP. |
Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), PE |
4-PAF386Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DPEP2 (Leu303~Leu486)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with PE. |
Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAF386Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DPEP2 (Leu303~Leu486)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with APC-Cy7. |
DPEP2 ELISA Kit (Human) (OKCD00464) |
OKCD00464 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Probable metalloprotease which hydrolyzes leukotriene D4 (LTD4) into leukotriene E4 (LTE4).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.069 ng/mL |
DPEP2 ELISA Kit (Human) (OKDD00240) |
OKDD00240 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathione degradation (Habib et al., 2003 [PubMed 12738806]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.069 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
DLR-DPEP3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Dipeptidase 3 (DPEP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 3 (DPEP3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
DLR-DPEP3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Dipeptidase 3 (DPEP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 3 (DPEP3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Dipeptidase 1(DPEP1) ELISA kit |
E01D0293-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dipeptidase 1(DPEP1) ELISA kit |
E01D0293-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dipeptidase 1(DPEP1) ELISA kit |
E01D0293-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
20-abx151321 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
ELISA kit for Human Dipeptidase 1 |
EK5021 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidase 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human DPEP1(Dipeptidase 1) ELISA Kit |
EH2498 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P16444
- Alias: DPEP1/Renal dipeptidase/hRDP/Dehydropeptidase-I/Microsomal dipeptidase/MDP/RDP
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human DPEP1/ Dipeptidase 1 ELISA Kit |
E0722Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Dipeptidase 1(DPEP1) ELISA kit |
CSB-EL007123HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Dipeptidase 1 (DPEP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Dipeptidase 1(DPEP1) ELISA kit |
1-CSB-EL007123HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Dipeptidase 1(DPEP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
RDR-DPEP3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
RDR-DPEP3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
SEF387Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids. |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
SEF387Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids. |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
SEF387Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids. |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
SEF387Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids. |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
4-SEF387Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dipeptidase 3 elisa. Alternative names of the recognized antigen: MBD3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidase 3 (DPEP3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
RD-DPEP3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dipeptidase 3 (DPEP3) ELISA Kit |
RD-DPEP3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
DPEP2 Antibody |
DF12958 |
Affbiotech |
200ul |
EUR 304 |
Description: DPEP2 Antibody detects endogenous levels of DPEP2. |
DPEP2 siRNA |
20-abx901563 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DPEP2 siRNA |
20-abx914529 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DPEP2 siRNA |
20-abx914530 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DPEP2 |
YF-PA20473 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to DPEP2 |
DPEP2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0626603 |
ABM |
1.0 ug DNA |
EUR 154 |
Human DPEP2 shRNA Plasmid |
20-abx961951 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DPEP2 Recombinant Protein (Human) |
RP009733 |
ABM |
100 ug |
Ask for price |
Human CNDP Dipeptidase 2 (CNDP2) Antibody |
32157-05111 |
AssayPro |
150 ug |
EUR 261 |
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
DLR-CNDP1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
DLR-CNDP1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids. |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
DLR-DPEP1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Dipeptidase 1, Renal (DPEP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 1, Renal (DPEP1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
DLR-DPEP1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Dipeptidase 1, Renal (DPEP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 1, Renal (DPEP1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
20-abx151101 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
20-abx151319 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Xaa-Pro dipeptidase (PEPD) ELISA Kit |
abx251813-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Xaa-Pro dipeptidase |
EK4921 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Xaa-Pro dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human PEPD(Xaa-Pro dipeptidase) ELISA Kit |
EH2449 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 3.125-200 ng/ml
- Uniprot ID: P12955
- Alias: PEPD/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml |
Human PEPD/ Xaa-Pro dipeptidase ELISA Kit |
E1906Hu |
Sunlong |
1 Kit |
EUR 605 |
ELISA kit for Human DPEP3 (Dipeptidase 3) |
ELK4127 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dipeptidase 3 (DPEP3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dipeptidase
- Show more
|
Description: A sandwich ELISA kit for detection of Dipeptidase 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
abx571875-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Dipeptidase 1 (DPEP1) |
KTE61987-48T |
Abbkine |
48T |
EUR 332 |
- DPEP1 (EC 3.4.13.11) is a kidney membrane enzyme that hydrolyzes a variety of dipeptides and is implicated in renal metabolism of glutathione and its conjugates, e.g., leukotriene D4 (Kozak and Tate, 1982).
DPEP1 is responsible for hydrolysis of the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 1 (DPEP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dipeptidase 1 (DPEP1) |
KTE61987-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DPEP1 (EC 3.4.13.11) is a kidney membrane enzyme that hydrolyzes a variety of dipeptides and is implicated in renal metabolism of glutathione and its conjugates, e.g., leukotriene D4 (Kozak and Tate, 1982).
DPEP1 is responsible for hydrolysis of the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 1 (DPEP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Dipeptidase 1 (DPEP1) |
KTE61987-96T |
Abbkine |
96T |
EUR 539 |
- DPEP1 (EC 3.4.13.11) is a kidney membrane enzyme that hydrolyzes a variety of dipeptides and is implicated in renal metabolism of glutathione and its conjugates, e.g., leukotriene D4 (Kozak and Tate, 1982).
DPEP1 is responsible for hydrolysis of the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 1 (DPEP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Carnosine Dipeptidase 1 ELISA Kit (CNDP1) |
RK01137 |
Abclonal |
96 Tests |
EUR 521 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RDR-CNDP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RDR-CNDP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
RDR-DPEP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
RDR-DPEP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
SEC441Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
SEC441Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
SEC441Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
SEC441Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
4-SEC441Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dipeptidase 1, Renal elisa. Alternative names of the recognized antigen: RDP
- MBD1
- MDP
- Dehydropeptidase-I
- Microsomal dipeptidase
- Renal dipeptidase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidase 1, Renal (DPEP1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
SEF388Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
SEF388Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
SEF388Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
SEF388Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
4-SEF388Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Carnosine Dipeptidase 1 elisa. Alternative names of the recognized antigen: CN1
- CPGL2
- Beta-Ala-His Dipeptidase
- Metallopeptidase M20
- Carnosinase 1
- Serum carnosinase
- Glutamate Carboxypeptidase-Like Protein 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RD-CNDP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RD-CNDP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
RD-DPEP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dipeptidase 1, Renal (DPEP1) ELISA Kit |
RD-DPEP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
DPEP2 Polyclonal Antibody |
29311-100ul |
SAB |
100ul |
EUR 252 |
DPEP2 Polyclonal Antibody |
29311-50ul |
SAB |
50ul |
EUR 187 |
DPEP2 Rabbit pAb |
A15502-100ul |
Abclonal |
100 ul |
EUR 308 |
DPEP2 Rabbit pAb |
A15502-200ul |
Abclonal |
200 ul |
EUR 459 |
DPEP2 Rabbit pAb |
A15502-20ul |
Abclonal |
20 ul |
EUR 183 |
DPEP2 Rabbit pAb |
A15502-50ul |
Abclonal |
50 ul |
EUR 223 |
DPEP2 Blocking Peptide |
DF12958-BP |
Affbiotech |
1mg |
EUR 195 |
DPEP2 cloning plasmid |
CSB-CL007124HU-10ug |
Cusabio |
10ug |
EUR 446 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1200
- Sequence: atgcagccctccggcctcgagggtcccggcacgtttggtcggtggcctctgctgagtctgctgctcctgctgctgctgctccagcctgtaacctgtgcctacaccacgccaggcccccccagagcccagttctggtcagcctatgtgccatgccagacccaggaccgggatgccc
- Show more
|
Description: A cloning plasmid for the DPEP2 gene. |
DPEP2 Rabbit pAb |
A19500-100ul |
Abclonal |
100 ul |
Ask for price |
DPEP2 Rabbit pAb |
A19500-200ul |
Abclonal |
200 ul |
Ask for price |
DPEP2 Rabbit pAb |
A19500-20ul |
Abclonal |
20 ul |
Ask for price |
DPEP2 Rabbit pAb |
A19500-50ul |
Abclonal |
50 ul |
EUR 308 |
anti- DPEP2 antibody |
FNab02514 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:20-1:200
- Immunogen: dipeptidase 2
- Uniprot ID: Q9H4A9
- Gene ID: 64174
- Research Area: Metabolism
|
Description: Antibody raised against DPEP2 |
Rat Dipeptidase 1(DPEP1) ELISA kit |
E02D0293-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dipeptidase 1(DPEP1) ELISA kit |
E02D0293-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dipeptidase 1(DPEP1) ELISA kit |
E02D0293-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dpep1/ Dipeptidase 1 ELISA Kit |
E0302Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Dipeptidase 1(DPEP1) ELISA kit |
E03D0293-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dipeptidase 1(DPEP1) ELISA kit |
E03D0293-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dipeptidase 1(DPEP1) ELISA kit |
E03D0293-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dpep1/ Dipeptidase 1 ELISA Kit |
E0419Mo |
Sunlong |
1 Kit |
EUR 632 |
Goat Dipeptidase 1(DPEP1) ELISA kit |
E06D0293-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Dipeptidase 1(DPEP1) ELISA kit |
E06D0293-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Dipeptidase 1(DPEP1) ELISA kit |
E06D0293-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Dipeptidase 1(DPEP1) ELISA kit |
E04D0293-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Dipeptidase 1(DPEP1) ELISA kit |
E04D0293-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Dipeptidase 1(DPEP1) ELISA kit |
E04D0293-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Dipeptidase 1(DPEP1) ELISA kit |
E09D0293-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Dipeptidase 1(DPEP1) ELISA kit |
E09D0293-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Dipeptidase 1(DPEP1) ELISA kit |
E09D0293-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Dipeptidase 1(DPEP1) ELISA kit |
E08D0293-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Dipeptidase 1(DPEP1) ELISA kit |
E08D0293-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Dipeptidase 1(DPEP1) ELISA kit |
E08D0293-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Dipeptidase 1(DPEP1) ELISA kit |
E07D0293-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Dipeptidase 1(DPEP1) ELISA kit |
E07D0293-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Dipeptidase 1(DPEP1) ELISA kit |
E07D0293-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human NAALAD2(N-acetylated-alpha-linked acidic dipeptidase 2) ELISA Kit |
EH14948 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human N-acetylated-alpha-linked acidic dipeptidase 2 (NAALAD2) ELISA Kit |
abx385188-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
CNDP2 CNDP Dipeptidase 2 Human Recombinant Protein |
PROTQ96KP4 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: CNDP2 Human Recombinant produced in E. coli is a single polypeptide chain containing 498 amino acids (1-475) and having a molecular mass of 55.3 kDa. CNDP2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
DPEP2 ORF Vector (Human) (pORF) |
ORF003245 |
ABM |
1.0 ug DNA |
EUR 95 |
Dpep1 ELISA Kit| Mouse Dipeptidase 1 ELISA Kit |
EF014700 |
Lifescience Market |
96 Tests |
EUR 689 |
DPEP1 ELISA Kit| Bovine Dipeptidase 1 ELISA Kit |
EF011322 |
Lifescience Market |
96 Tests |
EUR 689 |
Human β Ala His dipeptidase(CNDP1) ELISA kit |
E01B0887-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β Ala His dipeptidase(CNDP1) ELISA kit |
E01B0887-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β Ala His dipeptidase(CNDP1) ELISA kit |
E01B0887-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CNDP2/ Cytosolic non-specific dipeptidase ELISA Kit |
E0512Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Cytosolic non specific dipeptidase(CNDP2) ELISA kit |
E01C1842-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cytosolic non specific dipeptidase(CNDP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytosolic non specific dipeptidase(CNDP2) ELISA kit |
E01C1842-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cytosolic non specific dipeptidase(CNDP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytosolic non specific dipeptidase(CNDP2) ELISA kit |
E01C1842-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cytosolic non specific dipeptidase(CNDP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytosolic Non-Specific Dipeptidase (CNDP2) ELISA Kit |
abx250625-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Beta-Ala-His Dipeptidase (CNDP1) ELISA Kit |
abx250626-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Cytosolic non-specific dipeptidase |
EK2911 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cytosolic non-specific dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Beta-Ala-His dipeptidase |
EK2912 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Beta-Ala-His dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human CNDP1/ Beta-Ala-His dipeptidase ELISA Kit |
E2761Hu |
Sunlong |
1 Kit |
EUR 571 |
Human CNDP2(Cytosolic non-specific dipeptidase) ELISA Kit |
EH1355 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: Q96KP4
- Alias: CNDP2(Cytosolic non-specific dipeptidase)/CN2/CPGL/PEPA/CNDP dipeptidase 2/CNDP dipeptidase 2(metallopeptidase M20 family)/cytosolic nonspecific dipeptidase/Peptidase AGlutamate carboxypeptidas
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml |
Human CNDP1(Beta-Ala-His dipeptidase) ELISA Kit |
EH1356 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 1.56-100 ng/ml
- Uniprot ID: Q96KN2
- Alias: CNDP1(Carnosine Dipeptidase 1)/CPGL2/CN1/Carnosinase 1/beta-Ala-His dipeptidase/carnosine dipeptidase 1(metallopeptidase M20 family)/CNDP dipeptidase 1/Glutamate carboxypeptidase-like protein
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml |
Human Cytosolic non- specific dipeptidase, CNDP2 ELISA KIT |
ELI-03926h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Beta- Ala- His dipeptidase, CNDP1 ELISA KIT |
ELI-03930h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human CNDP1 (Carnosine Dipeptidase 1) |
ELK3128 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carnosine Dipeptidase 1 (CNDP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ca
- Show more
|
Description: A sandwich ELISA kit for detection of Carnosine Dipeptidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human DPEP1 (Dipeptidase 1, Renal) |
ELK4773 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dipeptidase 1, Renal (DPEP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dipep
- Show more
|
Description: A sandwich ELISA kit for detection of Dipeptidase 1, Renal from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit |
CSB-E16196h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit |
1-CSB-E16196h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Beta-Ala-His dipeptidase(CNDP1) ELISA kit |
CSB-EL005639HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Beta-Ala-His dipeptidase (CNDP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Beta-Ala-His dipeptidase(CNDP1) ELISA kit |
1-CSB-EL005639HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Beta-Ala-His dipeptidase(CNDP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Dipeptidase 3 (DPEP3) CLIA Kit |
20-abx494889 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Dpep2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6523103 |
ABM |
1.0 ug DNA |
EUR 154 |
Dpep2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3692403 |
ABM |
1.0 ug DNA |
EUR 154 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit |
CSB-EL017784MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit |
1-CSB-EL017784MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Guinea pig Dipeptidase 1(DPEP1) ELISA kit |
E05D0293-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Dipeptidase 1(DPEP1) ELISA kit |
E05D0293-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Dipeptidase 1(DPEP1) ELISA kit |
E05D0293-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Xaa-Pro dipeptidase (PEPD) ELISA Kit |
abx256674-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat Xaa-Pro dipeptidase |
EK4922 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Xaa-Pro dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Rat Pepd/ Xaa-Pro dipeptidase ELISA Kit |
E0748Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Xaa-Pro dipeptidase (PEPD) ELISA Kit |
abx521027-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Cow Dipeptidase 1, Renal (DPEP1) ELISA Kit |
abx521270-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Dipeptidase 1, Renal (DPEP1) ELISA Kit |
abx521272-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Pig Dipeptidase 1, Renal (DPEP1) ELISA Kit |
abx521273-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Dipeptidase 1, Renal (DPEP1) ELISA Kit |
abx521274-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Pepd(Xaa-Pro dipeptidase) ELISA Kit |
ER0699 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: Q5I0D7
- Alias: Pepd/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml |
Pepd ELISA Kit| Rat Xaa-Pro dipeptidase ELISA Kit |
EF017512 |
Lifescience Market |
96 Tests |
EUR 689 |
Pepd ELISA Kit| Mouse Xaa-Pro dipeptidase ELISA Kit |
EF015818 |
Lifescience Market |
96 Tests |
EUR 689 |
Rat DPEP2 shRNA Plasmid |
20-abx988545 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DPEP2 Polyclonal Conjugated Antibody |
C29311 |
SAB |
100ul |
EUR 397 |
Mouse DPEP2 shRNA Plasmid |
20-abx983268 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DPEP2 Recombinant Protein (Rat) |
RP198554 |
ABM |
100 ug |
Ask for price |
Human DPEP2(Dipeptidase 2) ELISA Kit