Human DPEP2(Dipeptidase 2) ELISA Kit

To Order: Contact us

Human Dipeptidase 2 (DPEP2) ELISA Kit
RDR-DPEP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Dipeptidase 2 (DPEP2) ELISA Kit
RD-DPEP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Dipeptidase 2 (DPEP2) ELISA Kit
RD-DPEP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Dipeptidase 2, DPEP2 ELISA KIT
ELI-47804h	Lifescience Market	96 Tests	EUR 824

Human Dipeptidase 2 (DPEP2) ELISA Kit
20-abx151320	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dipeptidase 2(DPEP2)ELISA Kit
QY-E03687	Qayee Biotechnology	96T	EUR 361

Human Dipeptidase 2 (DPEP2) ELISA Kit
SEF386Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids.

Human Dipeptidase 2 (DPEP2) ELISA Kit
SEF386Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids.

Human Dipeptidase 2 (DPEP2) ELISA Kit
SEF386Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids.

Human Dipeptidase 2 (DPEP2) ELISA Kit
SEF386Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids.

Human Dipeptidase 2 (DPEP2) ELISA Kit
4-SEF386Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Dipeptidase 2 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidase 2 (DPEP2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Dipeptidase 2, Dpep2 ELISA KIT
ELI-09175m	Lifescience Market	96 Tests	EUR 865

Dipeptidase 2 (DPEP2) Antibody
20-abx124752	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Dipeptidase 2 (DPEP2) Antibody
20-abx130482	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dipeptidase 2 (DPEP2) Antibody
abx122092-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Dipeptidase 2 (DPEP2) Antibody
20-abx172127	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Dipeptidase 2 (DPEP2) Antibody
abx232514-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Dipeptidase 2 (DPEP2)
4-RPF386Hu01	Cloud-Clone	EUR 350.88 EUR 197.00 EUR 1040.80 EUR 413.60 EUR 727.20 EUR 298.00 EUR 2452.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H4A9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Dipeptidase 2 expressed in: E.coli

ELISA kit for Human DPEP2 (Dipeptidase 2)
ELK4595	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dipeptidase 2 (DPEP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dipeptidase Show more
Description: A sandwich ELISA kit for detection of Dipeptidase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Dipeptidase 2 (DPEP2)
KTE61986-48T	Abbkine	48T	EUR 332
DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathio Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 2 (DPEP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dipeptidase 2 (DPEP2)
KTE61986-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathio Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 2 (DPEP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dipeptidase 2 (DPEP2)
KTE61986-96T	Abbkine	96T	EUR 539
DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathio Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 2 (DPEP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Dipeptidase 2 (DPEP2) CLIA Kit
20-abx494888	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Dipeptidase 2 (DPEP2) Protein
20-abx650658	Abbexa	EUR 495.00 EUR 244.00 EUR 1414.00 EUR 578.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse)
4-PAF386Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DPEP2 (Leu303~Leu486) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2)

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), APC
4-PAF386Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DPEP2 (Leu303~Leu486) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with APC.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAF386Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DPEP2 (Leu303~Leu486) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with Biotin.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), Cy3
4-PAF386Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DPEP2 (Leu303~Leu486) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with Cy3.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), FITC
4-PAF386Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DPEP2 (Leu303~Leu486) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with FITC.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), HRP
4-PAF386Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DPEP2 (Leu303~Leu486) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with HRP.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), PE
4-PAF386Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DPEP2 (Leu303~Leu486) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with PE.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAF386Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DPEP2 (Leu303~Leu486) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with APC-Cy7.

Dpep2/ Rat Dpep2 ELISA Kit
ELI-46906r	Lifescience Market	96 Tests	EUR 886

DPEP2 ELISA KIT|Human
EF009209	Lifescience Market	96 Tests	EUR 689

DPEP2 ELISA Kit (Human) (OKCD00464)
OKCD00464	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Probable metalloprotease which hydrolyzes leukotriene D4 (LTD4) into leukotriene E4 (LTE4).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.069 ng/mL

DPEP2 ELISA Kit (Human) (OKDD00240)
OKDD00240	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathione degradation (Habib et al., 2003 [PubMed 12738806]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.069 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Carnosine Dipeptidase 2(CNDP2)ELISA Kit
QY-E03018	Qayee Biotechnology	96T	EUR 400

Human Dipeptidase 1(DPEP1) ELISA kit
E01D0293-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidase 1(DPEP1) ELISA kit
E01D0293-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidase 1(DPEP1) ELISA kit
E01D0293-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Dipeptidase 1
EK5021	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human DPEP1/ Dipeptidase 1 ELISA Kit
E0722Hu	Sunlong	1 Kit	EUR 605

Human DPEP1(Dipeptidase 1) ELISA Kit
EH2498	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P16444 Alias: DPEP1/Renal dipeptidase/hRDP/Dehydropeptidase-I/Microsomal dipeptidase/MDP/RDP
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Dipeptidase 1, DPEP1 ELISA KIT
ELI-31993h	Lifescience Market	96 Tests	EUR 824

Human Dipeptidase 3, DPEP3 ELISA KIT
ELI-31994h	Lifescience Market	96 Tests	EUR 824

Human Dipeptidase 3 (DPEP3) ELISA Kit
20-abx151321	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dipeptidase 3 (DPEP3) ELISA Kit
DLR-DPEP3-Hu-48T	DL Develop	48T	EUR 517
Should the Human Dipeptidase 3 (DPEP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 3 (DPEP3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit
DLR-DPEP3-Hu-96T	DL Develop	96T	EUR 673
Should the Human Dipeptidase 3 (DPEP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 3 (DPEP3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dipeptidase 1(DPEP1) ELISA kit
CSB-EL007123HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Dipeptidase 1 (DPEP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Dipeptidase 1(DPEP1) ELISA kit
1-CSB-EL007123HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Dipeptidase 1(DPEP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Dipeptidase 3 (DPEP3) ELISA Kit
RDR-DPEP3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Dipeptidase 3 (DPEP3) ELISA Kit
RDR-DPEP3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Dipeptidase 3 (DPEP3) ELISA Kit
RD-DPEP3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Dipeptidase 3 (DPEP3) ELISA Kit
RD-DPEP3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Dipeptidase 3(DPEP3)ELISA Kit
QY-E03686	Qayee Biotechnology	96T	EUR 361

Human Dipeptidase 3 (DPEP3) ELISA Kit
SEF387Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit
SEF387Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit
SEF387Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit
SEF387Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit
4-SEF387Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Dipeptidase 3 elisa. Alternative names of the recognized antigen: MBD3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidase 3 (DPEP3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

DPEP2 siRNA
20-abx901563	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DPEP2 siRNA
20-abx914529	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DPEP2 siRNA
20-abx914530	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DPEP2 Antibody
DF12958	Affbiotech	200ul	EUR 304
Description: DPEP2 Antibody detects endogenous levels of DPEP2.

anti-DPEP2
YF-PA20473	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to DPEP2

DPEP2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0626603	ABM	1.0 ug DNA	EUR 154

Human DPEP2 shRNA Plasmid
20-abx961951	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DPEP2 Recombinant Protein (Human)
RP009733	ABM	100 ug	Ask for price

Human CNDP Dipeptidase 2 (CNDP2) Antibody
32157-05111	AssayPro	150 ug	EUR 261

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
abx571875-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Xaa-Pro dipeptidase
EK4921	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Xaa-Pro dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PEPD/ Xaa-Pro dipeptidase ELISA Kit
E1906Hu	Sunlong	1 Kit	EUR 605

Human PEPD(Xaa-Pro dipeptidase) ELISA Kit
EH2449	FN Test	96T	EUR 524.1
Detection range: 3.125-200 ng/ml Uniprot ID: P12955 Alias: PEPD/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human Xaa- Pro dipeptidase, PEPD ELISA KIT
ELI-07707h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human DPEP3 (Dipeptidase 3)
ELK4127	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dipeptidase 3 (DPEP3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dipeptidase Show more
Description: A sandwich ELISA kit for detection of Dipeptidase 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
20-abx151101	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
20-abx151319	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx251813-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
DLR-CNDP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
DLR-CNDP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
DLR-DPEP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Dipeptidase 1, Renal (DPEP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 1, Renal (DPEP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
DLR-DPEP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Dipeptidase 1, Renal (DPEP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 1, Renal (DPEP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

ELISA kit for Human Dipeptidase 1 (DPEP1)
KTE61987-48T	Abbkine	48T	EUR 332
DPEP1 (EC 3.4.13.11) is a kidney membrane enzyme that hydrolyzes a variety of dipeptides and is implicated in renal metabolism of glutathione and its conjugates, e.g., leukotriene D4 (Kozak and Tate, 1982). DPEP1 is responsible for hydrolysis of the Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 1 (DPEP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dipeptidase 1 (DPEP1)
KTE61987-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DPEP1 (EC 3.4.13.11) is a kidney membrane enzyme that hydrolyzes a variety of dipeptides and is implicated in renal metabolism of glutathione and its conjugates, e.g., leukotriene D4 (Kozak and Tate, 1982). DPEP1 is responsible for hydrolysis of the Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 1 (DPEP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dipeptidase 1 (DPEP1)
KTE61987-96T	Abbkine	96T	EUR 539
DPEP1 (EC 3.4.13.11) is a kidney membrane enzyme that hydrolyzes a variety of dipeptides and is implicated in renal metabolism of glutathione and its conjugates, e.g., leukotriene D4 (Kozak and Tate, 1982). DPEP1 is responsible for hydrolysis of the Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 1 (DPEP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
SEC441Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
SEC441Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
SEC441Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
SEC441Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
4-SEC441Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Dipeptidase 1, Renal elisa. Alternative names of the recognized antigen: RDP MBD1 MDP Dehydropeptidase-I Microsomal dipeptidase Renal dipeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidase 1, Renal (DPEP1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Carnosine Dipeptidase 1 ELISA Kit (CNDP1)
RK01137	Abclonal	96 Tests	EUR 521

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RDR-CNDP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RDR-CNDP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
RDR-DPEP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
RDR-DPEP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RD-CNDP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RD-CNDP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
RD-DPEP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit
RD-DPEP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Carnosine Dipeptidase 1(CNDP1)ELISA Kit
QY-E03019	Qayee Biotechnology	96T	EUR 400

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
SEF388Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
SEF388Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
SEF388Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
SEF388Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
4-SEF388Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Carnosine Dipeptidase 1 elisa. Alternative names of the recognized antigen: CN1 CPGL2 Beta-Ala-His Dipeptidase Metallopeptidase M20 Carnosinase 1 Serum carnosinase Glutamate Carboxypeptidase-Like Protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species.

DPEP2 cloning plasmid
CSB-CL007124HU-10ug	Cusabio	10ug	EUR 446
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1200 Sequence: atgcagccctccggcctcgagggtcccggcacgtttggtcggtggcctctgctgagtctgctgctcctgctgctgctgctccagcctgtaacctgtgcctacaccacgccaggcccccccagagcccagttctggtcagcctatgtgccatgccagacccaggaccgggatgccc Show more
Description: A cloning plasmid for the DPEP2 gene.

anti- DPEP2 antibody
FNab02514	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:2000 IHC: 1:20-1:200 Immunogen: dipeptidase 2 Uniprot ID: Q9H4A9 Gene ID: 64174 Research Area: Metabolism
Description: Antibody raised against DPEP2

DPEP2 Rabbit pAb
A15502-100ul	Abclonal	100 ul	EUR 308

DPEP2 Rabbit pAb
A15502-200ul	Abclonal	200 ul	EUR 459

DPEP2 Rabbit pAb
A15502-20ul	Abclonal	20 ul	EUR 183

DPEP2 Rabbit pAb
A15502-50ul	Abclonal	50 ul	EUR 223

DPEP2 Rabbit pAb
A19500-100ul	Abclonal	100 ul	Ask for price

DPEP2 Rabbit pAb
A19500-200ul	Abclonal	200 ul	Ask for price

DPEP2 Rabbit pAb
A19500-20ul	Abclonal	20 ul	Ask for price

DPEP2 Rabbit pAb
A19500-50ul	Abclonal	50 ul	EUR 308

DPEP2 Polyclonal Antibody
29311-100ul	SAB	100ul	EUR 252

DPEP2 Polyclonal Antibody
29311-50ul	SAB	50ul	EUR 187

DPEP2 Blocking Peptide
DF12958-BP	Affbiotech	1mg	EUR 195

Anti-DPEP2 antibody
PAab02514	Lifescience Market	100 ug	EUR 355

Anti-DPEP2 antibody
STJ11100693	St John's Laboratory	50 µl	EUR 287
Description: NA

Anti-DPEP2 antibody
STJ117697	St John's Laboratory	100 µl	EUR 277

Mouse Dpep1/ Dipeptidase 1 ELISA Kit
E0419Mo	Sunlong	1 Kit	EUR 632

Goat Dipeptidase 1(DPEP1) ELISA kit
E06D0293-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dipeptidase 1(DPEP1) ELISA kit
E06D0293-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dipeptidase 1(DPEP1) ELISA kit
E06D0293-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dipeptidase 1(DPEP1) ELISA kit
E02D0293-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dipeptidase 1(DPEP1) ELISA kit
E02D0293-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dipeptidase 1(DPEP1) ELISA kit
E02D0293-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dipeptidase 1(DPEP1) ELISA kit
E03D0293-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dipeptidase 1(DPEP1) ELISA kit
E03D0293-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dipeptidase 1(DPEP1) ELISA kit
E03D0293-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dipeptidase 1(DPEP1) ELISA kit
E04D0293-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dipeptidase 1(DPEP1) ELISA kit
E04D0293-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dipeptidase 1(DPEP1) ELISA kit
E04D0293-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dpep1/ Dipeptidase 1 ELISA Kit
E0302Ra	Sunlong	1 Kit	EUR 646

Dog Dipeptidase 1(DPEP1) ELISA kit
E08D0293-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dipeptidase 1(DPEP1) ELISA kit
E08D0293-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dipeptidase 1(DPEP1) ELISA kit
E08D0293-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dipeptidase 1(DPEP1) ELISA kit
E09D0293-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dipeptidase 1(DPEP1) ELISA kit
E09D0293-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dipeptidase 1(DPEP1) ELISA kit
E09D0293-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dipeptidase 1(DPEP1) ELISA kit
E07D0293-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dipeptidase 1(DPEP1) ELISA kit
E07D0293-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dipeptidase 1(DPEP1) ELISA kit
E07D0293-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Dipeptidase 1, DPEP1 ELISA KIT
ELI-09394p	Lifescience Market	96 Tests	EUR 928

Mouse Dipeptidase 3, Dpep3 ELISA KIT
ELI-32831m	Lifescience Market	96 Tests	EUR 865

Mouse Dipeptidase 1, Dpep1 ELISA KIT
ELI-46905m	Lifescience Market	96 Tests	EUR 865

Bovine Dipeptidase 1, DPEP1 ELISA KIT
ELI-47085b	Lifescience Market	96 Tests	EUR 928

Rabbit Dipeptidase 1, DPEP1 ELISA KIT
ELI-31738Ra	Lifescience Market	96 Tests	EUR 928

Human NAALAD2(N-acetylated-alpha-linked acidic dipeptidase 2) ELISA Kit
EH14948	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human N-acetylated-alpha-linked acidic dipeptidase 2 (NAALAD2) ELISA Kit
abx385188-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

DPEP2 ORF Vector (Human) (pORF)
ORF003245	ABM	1.0 ug DNA	EUR 95

CNDP2 CNDP Dipeptidase 2 Human Recombinant Protein
PROTQ96KP4	BosterBio	Regular: 20ug	EUR 317
Description: CNDP2 Human Recombinant produced in E. coli is a single polypeptide chain containing 498 amino acids (1-475) and having a molecular mass of 55.3 kDa. CNDP2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Dpep1 ELISA Kit| Rat Dipeptidase 1 ELISA Kit
EF018586	Lifescience Market	96 Tests	EUR 689

Dpep1 ELISA Kit| Mouse Dipeptidase 1 ELISA Kit
EF014700	Lifescience Market	96 Tests	EUR 689

DPEP1 ELISA Kit| Bovine Dipeptidase 1 ELISA Kit
EF011322	Lifescience Market	96 Tests	EUR 689

Human β Ala His dipeptidase(CNDP1) ELISA kit
E01B0887-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β Ala His dipeptidase(CNDP1) ELISA kit
E01B0887-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β Ala His dipeptidase(CNDP1) ELISA kit
E01B0887-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CNDP2/ Cytosolic non-specific dipeptidase ELISA Kit
E0512Hu	Sunlong	1 Kit	EUR 571

Human Cytosolic non specific dipeptidase(CNDP2) ELISA kit
E01C1842-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytosolic non specific dipeptidase(CNDP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytosolic non specific dipeptidase(CNDP2) ELISA kit
E01C1842-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytosolic non specific dipeptidase(CNDP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytosolic non specific dipeptidase(CNDP2) ELISA kit
E01C1842-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytosolic non specific dipeptidase(CNDP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Cytosolic non-specific dipeptidase
EK2911	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cytosolic non-specific dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Beta-Ala-His dipeptidase
EK2912	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Beta-Ala-His dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CNDP1/ Beta-Ala-His dipeptidase ELISA Kit
E2761Hu	Sunlong	1 Kit	EUR 571

Human CNDP2(Cytosolic non-specific dipeptidase) ELISA Kit
EH1355	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: Q96KP4 Alias: CNDP2(Cytosolic non-specific dipeptidase)/CN2/CPGL/PEPA/CNDP dipeptidase 2/CNDP dipeptidase 2(metallopeptidase M20 family)/cytosolic nonspecific dipeptidase/Peptidase AGlutamate carboxypeptidas Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human CNDP1(Beta-Ala-His dipeptidase) ELISA Kit
EH1356	FN Test	96T	EUR 567.6
Detection range: 1.56-100 ng/ml Uniprot ID: Q96KN2 Alias: CNDP1(Carnosine Dipeptidase 1)/CPGL2/CN1/Carnosinase 1/beta-Ala-His dipeptidase/carnosine dipeptidase 1(metallopeptidase M20 family)/CNDP dipeptidase 1/Glutamate carboxypeptidase-like protein Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Cytosolic non- specific dipeptidase, CNDP2 ELISA KIT
ELI-03926h	Lifescience Market	96 Tests	EUR 824

Human Beta- Ala- His dipeptidase, CNDP1 ELISA KIT
ELI-03930h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human CNDP1 (Carnosine Dipeptidase 1)
ELK3128	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carnosine Dipeptidase 1 (CNDP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ca Show more
Description: A sandwich ELISA kit for detection of Carnosine Dipeptidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human DPEP1 (Dipeptidase 1, Renal)
ELK4773	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dipeptidase 1, Renal (DPEP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dipep Show more
Description: A sandwich ELISA kit for detection of Dipeptidase 1, Renal from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cytosolic Non-Specific Dipeptidase (CNDP2) ELISA Kit
abx250625-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Beta-Ala-His Dipeptidase (CNDP1) ELISA Kit
abx250626-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit
CSB-E16196h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit
1-CSB-E16196h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Beta-Ala-His dipeptidase(CNDP1) ELISA kit
CSB-EL005639HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Beta-Ala-His dipeptidase (CNDP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Beta-Ala-His dipeptidase(CNDP1) ELISA kit
1-CSB-EL005639HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Beta-Ala-His dipeptidase(CNDP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Dipeptidase 3 (DPEP3) CLIA Kit
20-abx494889	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Dpep2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3692403	ABM	1.0 ug DNA	EUR 154

Dpep2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6523103	ABM	1.0 ug DNA	EUR 154

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx521027-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Cow Dipeptidase 1, Renal (DPEP1) ELISA Kit
abx521270-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Dipeptidase 1, Renal (DPEP1) ELISA Kit
abx521272-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Pig Dipeptidase 1, Renal (DPEP1) ELISA Kit
abx521273-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Dipeptidase 1, Renal (DPEP1) ELISA Kit
abx521274-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Guinea pig Dipeptidase 1(DPEP1) ELISA kit
E05D0293-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dipeptidase 1(DPEP1) ELISA kit
E05D0293-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dipeptidase 1(DPEP1) ELISA kit
E05D0293-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Xaa-Pro dipeptidase
EK4922	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Xaa-Pro dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Pepd/ Xaa-Pro dipeptidase ELISA Kit
E0748Ra	Sunlong	1 Kit	EUR 646

Rat Xaa- Pro dipeptidase, Pepd ELISA KIT
ELI-07705r	Lifescience Market	96 Tests	EUR 886

Mouse Xaa- Pro dipeptidase, Pepd ELISA KIT
ELI-07706m	Lifescience Market	96 Tests	EUR 865

Rat Pepd(Xaa-Pro dipeptidase) ELISA Kit
ER0699	FN Test	96T	EUR 567.6
Detection range: 0.625-40 ng/ml Uniprot ID: Q5I0D7 Alias: Pepd/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

Rat Xaa-Pro dipeptidase (PEPD) ELISA Kit
abx256674-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit
CSB-EL017784MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit
1-CSB-EL017784MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

DPEP2 Polyclonal Conjugated Antibody
C29311	SAB	100ul	EUR 397

Rat DPEP2 shRNA Plasmid
20-abx988545	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse DPEP2 shRNA Plasmid
20-abx983268	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DPEP2 Recombinant Protein (Rat)
RP198554	ABM	100 ug	Ask for price

DPEP2 Recombinant Protein (Mouse)
RP129893	ABM	100 ug	Ask for price

Pepd ELISA Kit| Mouse Xaa-Pro dipeptidase ELISA Kit
EF015818	Lifescience Market	96 Tests	EUR 689

Human DPEP2(Dipeptidase 2) ELISA Kit