Human DPAGT1(Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1) ELISA Kit

To Order: Contact us

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RDR-DPAGT1-Hu-48Tests 48 Tests
EUR 544

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RDR-DPAGT1-Hu-96Tests 96 Tests
EUR 756

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RD-DPAGT1-Hu-48Tests 48 Tests
EUR 521

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RD-DPAGT1-Hu-96Tests 96 Tests
EUR 723

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx027715-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx027715-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx034594-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx034594-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 elisa. Alternative names of the recognized antigen: ALG7
  • CDG-Ij
  • DGPT
  • DPAGT2
  • G1PT
  • GPT
  • UAGT
  • UGAT
  • GlcNAc-1-P Transferase
  • UDP-N-acetylglucosamine--dolichyl-phosphate
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human DPAGT1 (Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1)

ELK4380 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1). Standards or samples are then added to the appropriate microtiter plate wells with a bioti
  • Show more
Description: A sandwich ELISA kit for detection of Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase (DPAGT1)

KTE61988-48T 48T
EUR 332
  • DPAGT1 is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic r
  • Show more
Description: Quantitative sandwich ELISA for measuring Human UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase (DPAGT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase (DPAGT1)

KTE61988-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DPAGT1 is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic r
  • Show more
Description: Quantitative sandwich ELISA for measuring Human UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase (DPAGT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase (DPAGT1)

KTE61988-96T 96T
EUR 539
  • DPAGT1 is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic r
  • Show more
Description: Quantitative sandwich ELISA for measuring Human UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase (DPAGT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human UDP- N- acetylglucosamine- - dolichyl- phosphate N- acetyl

ELI-39007h 96 Tests
EUR 824

Mouse UDP- N- acetylglucosamine- - dolichyl- phosphate N- acetyl

ELI-27484m 96 Tests
EUR 865

Bovine UDP- N- acetylglucosamine- - dolichyl- phosphate N- acety

ELI-47979b 96 Tests
EUR 928

Human ALG5, Dolichyl-Phosphate Beta-Glucosyltransferase (ALG5) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

DPAGT1 ELISA Kit (Human) (OKCD09162)

OKCD09162 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic reticulum. The congenital disorder of glycosylation type Ij is caused by mutation in the gene encoding this enzyme.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

DPAGT1 ELISA Kit (Human) (OKDD00239)

OKDD00239 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic reticulum. The congenital disorder of glycosylation type Ij is caused by mutation in the gene encoding this enzyme.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

Dolichyl-phosphate mannosyltransferase polypeptide 1 (DPM1) polyclonal antibody

ABP-PAB-01185 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:


B6707-1 1 mg
EUR 181
Description: Sphingosine-1-phosphate is an endogenous second messenger that involved in cell proliferation and survival and is a ligand for S1PR1 [1] [2].

ALG5, Dolichyl-Phosphate Beta-Glucosyltransferase (ALG5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ALG5, Dolichyl-Phosphate Beta-Glucosyltransferase (ALG5) Antibody

abx029842-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ALG5, Dolichyl-Phosphate Beta-Glucosyltransferase (ALG5) Antibody

abx029842-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ALG5, Dolichyl-Phosphate Beta-Glucosyltransferase (ALG5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ALG5, Dolichyl-Phosphate Beta-Glucosyltransferase (ALG5) Antibody

abx230307-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

R-1 Methanandamide Phosphate

C3352-1 1 mg
EUR 126
Description: R-1 Methanandamide Phosphate,a water soluble prodrug analog of AEA, exhibited similar activity to that of AEA in the growth inhibition of C6 glioma cells[1]. Arachidonoyl ethanolamide (AEA) was the first endogenous cannabinoid (CB).

DPAGT1 Protein Vector (Human) (pPB-N-His)

PV012966 500 ng
EUR 329

Human Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) ELISA Kit

abx387617-96tests 96 tests
EUR 911
  • Shipped within 20 working days.

ALG5, Dolichyl-Phosphate Beta-Glucosyltransferase (ALG5) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ALG5, Dolichyl-Phosphate Beta-Glucosyltransferase (ALG5) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ALG5, Dolichyl-Phosphate Beta-Glucosyltransferase (ALG5) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DPAGT1 Antibody

25355-100ul 100ul
EUR 390


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18256 2 ug
EUR 231

Human DPAGT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPAGT1 Recombinant Protein (Human)

RP009724 100 ug Ask for price

Human sphingosine 1-phosphate ELISA kit

E01S0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human sphingosine 1-phosphate ELISA kit

E01S0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human sphingosine 1-phosphate ELISA kit

E01S0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Sphingosine 1 Phosphate ELISA KIT|Human

EF006568 96 Tests
EUR 689

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

DPAGT1 Protein Vector (Mouse) (pPB-N-His)

PV173179 500 ng
EUR 603

DPAGT1 Protein Vector (Rat) (pPB-N-His)

PV264727 500 ng
EUR 603

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mouse Glucosamine-Phosphate N-Acetyltransferase 1 (GNPNAT1) ELISA Kit

abx389412-96tests 96 tests
EUR 911
  • Shipped within 20 working days.

DPAGT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0626302 1.0 ug DNA
EUR 154

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

DPAGT1 cloning plasmid

CSB-CL884460HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atgtgggccttctcggaattgcccatgccgctgctgatcaatttgatcgtctcgctgctgggatttgtggccacagtcaccctcatcccggccttccggggccacttcattgctgcgcgcctctgtggtcaggacctcaacaaaaccagccgacagcagatcccagaatcccagg
  • Show more
Description: A cloning plasmid for the DPAGT1 gene.


PVT19083 2 ug
EUR 231

Anti-DPAGT1 (1G1)

YF-MA12723 100 ug
EUR 363
Description: Mouse monoclonal to DPAGT1

AG-014699 phosphate

EUR 131

KN-93 Phosphate

B4969-1 1 mg
EUR 116
Description: KN-93 phosphate is the water soluble form of KN-93. It is a potent, selective and cell permeable inhibitor of CaM kinase II (IC50= 0.37 ?m, Ki=370 nm) [1]CaMK II is a multifunctional serine/threonine kinase with various roles in different physiological systems.

Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E01D0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E01D0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E01D0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Glucosamine-Phosphate N-Acetyltransferase 1

7-02866 2µg Ask for price

Recombinant Human Glucosamine-Phosphate N-Acetyltransferase 1

7-02867 10µg Ask for price

Recombinant Human Glucosamine-Phosphate N-Acetyltransferase 1

7-02868 1mg Ask for price

Human Sphingosine 1 Phosphate Receptor 1 ELISA Kit

ELA-E9909h 96 Tests
EUR 824

DPAGT1 ORF Vector (Human) (pORF)

ORF003242 1.0 ug DNA
EUR 95

Human sphingosine 1 phosphate,S1P ELISA Kit

201-12-1861 96 tests
EUR 440
  • This sphingosine 1 phosphate ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sphingosine 1 Phosphate (S1P) ELISA Kit

abx251939-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human S1P(Sphingosine 1 Phosphate) ELISA Kit

EH2564 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: Q14703
  • Alias: S1P
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human sphingosine 1 phosphate(S1P)ELISA Kit

GA-E1877HM-48T 48T
EUR 289

Human sphingosine 1 phosphate(S1P)ELISA Kit

GA-E1877HM-96T 96T
EUR 466

Human sphingosine 1 phosphate(S1P)ELISA Kit

QY-E05252 96T
EUR 361

Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) ELISA Kit

abx251427-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) ELISA Kit

SEJ279Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) ELISA Kit

SEJ279Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) ELISA Kit

SEJ279Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) ELISA Kit

SEJ279Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase elisa. Alternative names of the recognized antigen: AGE-R1
  • OK/SW-cl.45
  • OST
  • OST48
  • WBP1
  • Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit
  • Olig
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human N-acetylglucosamine-6-phosphate deacetylase (AMDHD2) ELISA Kit

abx384576-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Glucosamine-Phosphate N-Acetyltransferase 1 (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

DERA Deoxyribose-Phosphate Aldolase Human Recombinant Protein

PROTQ9Y315-1 Regular: 10ug
EUR 317
Description: DERA Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 338 amino acids (1-318) and having a molecular mass of 37.3 kDa.;DERA is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Human Prothrombin (Factor II) (>95%) for ELISA

PRTN15-N-1 1 mg
EUR 225

Rabbit sphingosine 1-phosphate ELISA kit

E04S0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit sphingosine 1-phosphate ELISA kit

E04S0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit sphingosine 1-phosphate ELISA kit

E04S0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat sphingosine 1-phosphate ELISA kit

E02S0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat sphingosine 1-phosphate ELISA kit

E02S0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat sphingosine 1-phosphate ELISA kit

E02S0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse sphingosine 1-phosphate ELISA kit

E03S0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse sphingosine 1-phosphate ELISA kit

E03S0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse sphingosine 1-phosphate ELISA kit

E03S0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog sphingosine 1-phosphate ELISA kit

E08S0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog sphingosine 1-phosphate ELISA kit

E08S0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog sphingosine 1-phosphate ELISA kit

E08S0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig sphingosine 1-phosphate ELISA kit

E07S0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig sphingosine 1-phosphate ELISA kit

E07S0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig sphingosine 1-phosphate ELISA kit

E07S0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey sphingosine 1-phosphate ELISA kit

E09S0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey sphingosine 1-phosphate ELISA kit

E09S0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey sphingosine 1-phosphate ELISA kit

E09S0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat sphingosine 1-phosphate ELISA kit

E06S0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat sphingosine 1-phosphate ELISA kit

E06S0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat sphingosine 1-phosphate ELISA kit

E06S0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat sphingosine 1-phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Sphingosine-1-Phosphate (S1P) ELISA Kit

  • EUR 8709.00
  • EUR 4638.00
  • EUR 1067.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Creatine Phosphate ELISA kit

E01C0083-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Creatine Phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Creatine Phosphate ELISA kit

E01C0083-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Creatine Phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Creatine Phosphate ELISA kit

E01C0083-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Creatine Phosphate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

DLR-S1PR1-Hu-48T 48T
EUR 517
  • Should the Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

DLR-S1PR1-Hu-96T 96T
EUR 673
  • Should the Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

DLR-SGPP1-Hu-48T 48T
EUR 517
  • Should the Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

DLR-SGPP1-Hu-96T 96T
EUR 673
  • Should the Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sphingosine 1 Phosphate Lyase 1 (SGPL1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

abx250537-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Sphingosine 1-phosphate receptor 1 (S1PR1) ELISA Kit

abx250888-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Sphingosine-1-phosphate lyase 1 (SGPL1) ELISA Kit

abx251015-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Human Sphingosine-1-phosphate phosphatase 1

EK2790 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sphingosine-1-phosphate phosphatase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Sphingosine 1-phosphate receptor 1

EK3394 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sphingosine 1-phosphate receptor 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Sphingosine-1-phosphate lyase 1

EK3566 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sphingosine-1-phosphate lyase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human S1PR1/ Sphingosine 1-phosphate receptor 1 ELISA Kit

E2202Hu 1 Kit
EUR 571

Human SGPL1/ Sphingosine-1-phosphate lyase 1 ELISA Kit

E2279Hu 1 Kit
EUR 605

Human SGPP1/ Sphingosine-1-phosphate phosphatase 1 ELISA Kit

E2280Hu 1 Kit
EUR 605

Human SGPP1(Sphingosine-1-phosphate phosphatase 1) ELISA Kit

EH1275 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q9BX95
  • Alias: SGPP1/Sphingosine-1-phosphate phosphatase 1/SPPase1/Spp1/hSPP1/hSPPase1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human S1PR1(Sphingosine 1-phosphate receptor 1) ELISA Kit

EH1597 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P21453
  • Alias: S1PR1/Sphingosine 1-phosphate receptor 1/S1P receptor 1/S1P1/Endothelial differentiation G-protein coupled receptor 1/Sphingosine 1-phosphate receptor Edg-1/S1P receptor Edg-1
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Sphingosine- 1- phosphate lyase 1, SGPL1 ELISA KIT

ELI-18650h 96 Tests
EUR 824

Human Sphingosine- 1- phosphate phosphatase 1, SGPP1 ELISA KIT

ELI-03690h 96 Tests
EUR 824

Human Sphingosine 1- phosphate receptor 1, S1PR1 ELISA KIT

ELI-04681h 96 Tests
EUR 824

Human Methylthioribose-1-Phosphate Isomerase 1 (MRI1) ELISA Kit

abx381521-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

abx571617-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Sphingosine 1-phosphate receptor 1 (S1PR1) ELISA Kit

abx571650-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Sphingosine 1 Phosphate Receptor 1 ELISA Kit (S1PR1)

RK02236 96 Tests
EUR 521

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

RD-SGPP1-Hu-48Tests 48 Tests
EUR 521

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

RD-SGPP1-Hu-96Tests 96 Tests
EUR 723

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

SEE696Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

SEE696Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

SEE696Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

SEE696Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sphingosine-1-Phosphate Phosphatase 1 elisa. Alternative names of the recognized antigen: SPPase1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

SEC937Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) in tissue homogenates, cell lysates and other biological fluids.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

SEC937Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) in tissue homogenates, cell lysates and other biological fluids.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

SEC937Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) in tissue homogenates, cell lysates and other biological fluids.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

SEC937Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) in tissue homogenates, cell lysates and other biological fluids.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sphingosine 1 Phosphate Receptor 1 elisa. Alternative names of the recognized antigen: CD363
  • EDG1
  • S1-PR1
  • S1P1
  • ECGF1
  • CHEDG1
  • Endothelial differentiation G-protein coupled receptor 1
  • Sphingolipid G-Protein-Coupled Receptor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RDR-S1PR1-Hu-48Tests 48 Tests
EUR 544

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RDR-S1PR1-Hu-96Tests 96 Tests
EUR 756

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

RDR-SGPP1-Hu-48Tests 48 Tests
EUR 544

Human Sphingosine-1-Phosphate Phosphatase 1 (SGPP1) ELISA Kit

RDR-SGPP1-Hu-96Tests 96 Tests
EUR 756

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RD-S1PR1-Hu-48Tests 48 Tests
EUR 521

Human Sphingosine 1 Phosphate Receptor 1 (S1PR1) ELISA Kit

RD-S1PR1-Hu-96Tests 96 Tests
EUR 723

Mouse DPAGT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPAGT1 Recombinant Protein (Rat)

RP198542 100 ug Ask for price

DPAGT1 Recombinant Protein (Mouse)

RP129881 100 ug Ask for price

Dad1 ELISA Kit| Rat Dolichyl-diphosphooligosaccharide--protein

EF018558 96 Tests
EUR 689

Rpn1 ELISA Kit| Rat Dolichyl-diphosphooligosaccharide--protein

EF019270 96 Tests
EUR 689

Rpn2 ELISA Kit| Rat Dolichyl-diphosphooligosaccharide--protein

EF019271 96 Tests
EUR 689

Dad1 ELISA Kit| Mouse Dolichyl-diphosphooligosaccharide--protei

EF014647 96 Tests
EUR 689

Rpn1 ELISA Kit| Mouse Dolichyl-diphosphooligosaccharide--protei

EF016099 96 Tests
EUR 689

Rpn2 ELISA Kit| Mouse Dolichyl-diphosphooligosaccharide--protei

EF016100 96 Tests
EUR 689

DAD1 ELISA Kit| Bovine Dolichyl-diphosphooligosaccharide--prote

EF011295 96 Tests
EUR 689

RPN2 ELISA Kit| Bovine Dolichyl-diphosphooligosaccharide--prote

EF011860 96 Tests
EUR 689

DAD1 ELISA Kit| chicken Dolichyl-diphosphooligosaccharide--prot

EF012273 96 Tests
EUR 689

RPN1 ELISA Kit| chicken Dolichyl-diphosphooligosaccharide--prot

EF012495 96 Tests
EUR 689

RPN2 ELISA Kit| chicken Dolichyl-diphosphooligosaccharide--prot

EF012496 96 Tests
EUR 689

Human Galactose-1-Phosphate Uridylyltransferase (GALT) ELISA Kit

EUR 517
  • Should the Human Galactose-1-Phosphate Uridylyltransferase (GALT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Galactose-1-Phosphate Uridylyltransferase (GALT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Galactose-1-Phosphate Uridylyltransferase (GALT) ELISA Kit

EUR 673
  • Should the Human Galactose-1-Phosphate Uridylyltransferase (GALT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Galactose-1-Phosphate Uridylyltransferase (GALT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lipid phosphate phosphohydrolase 1(PPAP2A) ELISA kit

E01L0336-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipid phosphate phosphohydrolase 1(PPAP2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipid phosphate phosphohydrolase 1(PPAP2A) ELISA kit

E01L0336-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipid phosphate phosphohydrolase 1(PPAP2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipid phosphate phosphohydrolase 1(PPAP2A) ELISA kit

E01L0336-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipid phosphate phosphohydrolase 1(PPAP2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PPAP2A/ Lipid phosphate phosphohydrolase 1 ELISA Kit

E2001Hu 1 Kit
EUR 605

Human Methylthioribose- 1- phosphate isomerase, MRI1 ELISA KIT

ELI-12928h 96 Tests
EUR 824

Human Fucose- 1- phosphate guanylyltransferase, FPGT ELISA KIT

ELI-27526h 96 Tests
EUR 824

Human Ribose- phosphate pyrophosphokinase 1, PRPS1 ELISA KIT

ELI-45682h 96 Tests
EUR 824

Human Galactose-1-phosphate uridylyltransferase(GALT) ELISA kit

CSB-EL009226HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Galactose-1-phosphate uridylyltransferase (GALT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Galactose-1-phosphate uridylyltransferase(GALT) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Galactose-1-phosphate uridylyltransferase(GALT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Galactose-1-Phosphate Uridylyltransferase (GALT) ELISA Kit

abx352188-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Ribose-phosphate pyrophosphokinase 1 (PRPS1) ELISA Kit

abx382486-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Fucose-1-Phosphate Guanylyltransferase (FPGT) ELISA Kit

abx387417-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Lipid phosphate phosphohydrolase 1, PPAP2A ELISA KIT

ELI-37430h 96 Tests
EUR 824

Human Galactose-1-Phosphate Uridylyltransferase (GALT) ELISA Kit

RDR-GALT-Hu-48Tests 48 Tests
EUR 544

Human Galactose-1-Phosphate Uridylyltransferase (GALT) ELISA Kit

RDR-GALT-Hu-96Tests 96 Tests
EUR 756

Human Galactose-1-Phosphate Uridylyltransferase (GALT) ELISA Kit

RD-GALT-Hu-48Tests 48 Tests
EUR 521

Human Galactose-1-Phosphate Uridylyltransferase (GALT) ELISA Kit

RD-GALT-Hu-96Tests 96 Tests
EUR 723


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Rat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E02D0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E02D0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E02D0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E03D0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E03D0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E03D0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E06D0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E06D0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E06D0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E04D0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E04D0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E04D0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E09D0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E09D0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E09D0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E08D0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E08D0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E08D0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E07D0306-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E07D0306-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) ELISA kit

E07D0306-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dolichyl diphosphooligosaccharide protein glycosyltransferase subunit 1(RPN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1 (RPN1) ELISA Kit

abx391910-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1 (RPN1) ELISA Kit

abx390457-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human DDOST (Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase)

ELK5285 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST). Standards or samples are then added to the appropriate microtiter plate wells with a bio
  • Show more
Description: A sandwich ELISA kit for detection of Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Dpagt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4848802 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6619602 1.0 ug DNA
EUR 154

G6PD Glucose-6-Phosphate Dehydrogenase Human Recombinant Protein

PROTP11413-1 Regular: 20ug
EUR 317
Description: G6PD Human Recombinant produced in Hi-5 cells is a single polypeptide chain containing 535 amino acids (1-515) and having a molecular mass of 61.4kDa.;G6PD is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Purified human beta-Actin (non-muscle) Protein for ELISA

ACTB16-N-1 1 mg
EUR 773

Human DPAGT1(Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1) ELISA Kit