Human TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit

Human TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit

To Order: Contact us

Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Hu-96T 96T
EUR 621
  • Should the Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Hu-48Tests 48 Tests
EUR 500
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Hu-96Tests 96 Tests
EUR 692
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Hu-48Tests 48 Tests
EUR 478
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Hu-96Tests 96 Tests
EUR 662
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Mu-48T 48T
EUR 489
  • Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
DLR-TPPP-Mu-96T 96T
EUR 635
  • Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Mu-48Tests 48 Tests
EUR 511
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RDR-TPPP-Mu-96Tests 96 Tests
EUR 709
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Mu-48Tests 48 Tests
EUR 489
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
RD-TPPP-Mu-96Tests 96 Tests
EUR 677
Human Tubulin polymerization-promoting protein (TPPP)
1-CSB-EP024115HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tubulin polymerization-promoting protein(TPPP) expressed in E.coli
Tubulin Polymerization Promoting Protein (TPPP) Protein
20-abx262669
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx123553
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx116340
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx104140
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx029266-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx029266-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx174961
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx322624
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx430016-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx238897-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
abx238898-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx178749
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tubulin Polymerization Promoting Protein (TPPP) Antibody
20-abx178750
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Tubulin Polymerization Promoting Protein (TPPP)
4-RPA993Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O94811
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.8kDa
  • Isoelectric Point: 9.5
Description: Recombinant Human Tubulin Polymerization Promoting Protein expressed in: E.coli
Human TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit
EH3905 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: O94811
  • Alias: TPPP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml
Human Tubulin polymerization- promoting protein, TPPP ELISA KIT
ELI-45590h 96 Tests
EUR 824
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
20-abx153365
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx253305-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
SEA993Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in tissue homogenates, cell lysates and other biological fluids.
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
SEA993Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in tissue homogenates, cell lysates and other biological fluids.
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
SEA993Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in tissue homogenates, cell lysates and other biological fluids.
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
SEA993Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in tissue homogenates, cell lysates and other biological fluids.
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
4-SEA993Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tubulin Polymerization Promoting Protein elisa. Alternative names of the recognized antigen: TPPP1
  • p25alpha
  • p25
  • TPPP/p25
  • Brain Specific Protein p25 Alpha
  • 25 kDa brain-specific protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Tubulin Polymerization Promoting Protein ELISA Kit (TPPP)
RK02438 96 Tests
EUR 521
Human Tubulin Polymerization Promoting Protein(TPPP)ELISA Kit
QY-E03958 96T
EUR 361
Human Tubulin Polymerization Promoting Protein (TPPP) Protein
20-abx069525
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Pig Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx361306-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx362823-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx364178-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Bovine Tubulin polymerization- promoting protein, TPPP ELISA KIT
ELI-17189b 96 Tests
EUR 928
Mouse Tubulin polymerization- promoting protein, Tppp ELISA KIT
ELI-36678m 96 Tests
EUR 865
Mouse TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit
EM1421 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q7TQD2
  • Alias: TPPP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
20-abx154797
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx353997-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Chicken Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx356474-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx359495-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx254480-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
SEA993Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in Tissue homogenates and other biological fluids.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
SEA993Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in Tissue homogenates and other biological fluids.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
SEA993Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in Tissue homogenates and other biological fluids.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
SEA993Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in Tissue homogenates and other biological fluids.
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
4-SEA993Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tubulin Polymerization Promoting Protein elisa. Alternative names of the recognized antigen: TPPP1
  • p25alpha
  • p25
  • TPPP/p25
  • Brain Specific Protein p25 Alpha
  • 25 kDa brain-specific protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Rat Tubulin Polymerization Promoting Protein(TPPP)ELISA Kit
QY-E10112 96T
EUR 361
Mouse Tubulin Polymerization Promoting Protein(TPPP)ELISA Kit
QY-E21535 96T
EUR 361
Human Tubulin Polymerization Promoting Protein (TPPP) CLIA Kit
20-abx492302
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Tubulin Polymerization Promoting Protein (TPPP) Protein
20-abx655371
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Tubulin Polymerization Promoting Protein (TPPP) Protein
20-abx655372
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
ELISA kit for Human TPPP (Tubulin Polymerization Promoting Protein)
E-EL-H2031 1 plate of 96 wells
EUR 534
  • Gentaur's TPPP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPPP. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TPPP (Tubulin Polymerization Promoting Protein) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human TPPP (Tubulin Polymerization Promoting Protein)
ELK4628 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tubulin Polymerization Promoting Protein (TPPP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibod
  • Show more
Description: A sandwich ELISA kit for detection of Tubulin Polymerization Promoting Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Tubulin polymerization-promoting protein (TPPP)
KTE60144-48T 48T
EUR 332
  • Seki et al. (1999) cloned p25 from a neuroblastoma cDNA library. The deduced 219-amino acid protein has a calculated molecular mass of about 24 kD. Human and bovine p25 share 90% amino acid identity. In contrast to the brain-specific expression of bo
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Tubulin polymerization-promoting protein (TPPP)
KTE60144-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Seki et al. (1999) cloned p25 from a neuroblastoma cDNA library. The deduced 219-amino acid protein has a calculated molecular mass of about 24 kD. Human and bovine p25 share 90% amino acid identity. In contrast to the brain-specific expression of bo
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Tubulin polymerization-promoting protein (TPPP)
KTE60144-96T 96T
EUR 539
  • Seki et al. (1999) cloned p25 from a neuroblastoma cDNA library. The deduced 219-amino acid protein has a calculated molecular mass of about 24 kD. Human and bovine p25 share 90% amino acid identity. In contrast to the brain-specific expression of bo
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
TPPP Tubulin Polymerization Promoting Protein Human Recombinant Protein
PROTO94811 Regular: 10ug
EUR 317
Description: TPPP Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 229 amino acids including a 10 a.a N-terminal His tag. The total molecular mass is 24.9kDa (calculated).
Mouse Tubulin Polymerization Promoting Protein (TPPP) CLIA Kit
20-abx492303
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
TPPP ELISA Kit| Mouse Tubulin Polymerization Promoting Protein E
EF013945 96 Tests
EUR 689
ELISA kit for Mouse TPPP (Tubulin Polymerization Promoting Protein)
ELK2645 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tubulin Polymerization Promoting Protein (TPPP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibod
  • Show more
Description: A sandwich ELISA kit for detection of Tubulin Polymerization Promoting Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Guinea pig Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit
abx357445-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
ELISA kit for Mouse TPPP (Tubulin Polymerization Promoting Protein)
E-EL-M1209 1 plate of 96 wells
EUR 534
  • Gentaur's TPPP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse TPPP. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse TPPP (Tubulin Polymerization Promoting Protein) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Rat TPPP (Tubulin Polymerization Promoting Protein)
E-EL-R1034 1 plate of 96 wells
EUR 534
  • Gentaur's TPPP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat TPPP. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat TPPP (Tubulin Polymerization Promoting Protein) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Mouse Tubulin polymerization-promoting protein (TPPP)
KTE70063-48T 48T
EUR 332
  • The novel basic, heat-stable tubulin polymerization promoting protein TPPP/p25 is associated with microtubules in vitro and can induce the formation of aberrant microtubule assemblies. Immunohistochemistry and confocal microscopy demonstrates that TP
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Tubulin polymerization-promoting protein (TPPP)
KTE70063-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The novel basic, heat-stable tubulin polymerization promoting protein TPPP/p25 is associated with microtubules in vitro and can induce the formation of aberrant microtubule assemblies. Immunohistochemistry and confocal microscopy demonstrates that TP
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Tubulin polymerization-promoting protein (TPPP)
KTE70063-96T 96T
EUR 539
  • The novel basic, heat-stable tubulin polymerization promoting protein TPPP/p25 is associated with microtubules in vitro and can induce the formation of aberrant microtubule assemblies. Immunohistochemistry and confocal microscopy demonstrates that TP
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse)
4-PAA993Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP)
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), APC
4-PAA993Hu01-APC
  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with APC.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA993Hu01-Biotin
  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Biotin.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA993Hu01-Cy3
  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Cy3.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), FITC
4-PAA993Hu01-FITC
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with FITC.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), HRP
4-PAA993Hu01-HRP
  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with HRP.
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), PE
4-PAA993Hu01-PE
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with PE.
Human Tubulin Polymerization Promoting Protein ELISA kit
E01T0313-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tubulin Polymerization Promoting Protein ELISA kit
E01T0313-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tubulin Polymerization Promoting Protein ELISA kit
E01T0313-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
anti-Tubulin Polymerization Promoting Protein
YF-PA17418 50 ug
EUR 363
Description: Mouse polyclonal to Tubulin Polymerization Promoting Protein
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAA993Hu01-APC-Cy7
  • EUR 526.00
  • EUR 5782.00
  • EUR 1543.00
  • EUR 695.00
  • EUR 299.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPPP (Ala8~Thr210)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with APC-Cy7.
Mouse Tubulin Polymerization Promoting Protein ELISA kit
E03T0313-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Tubulin Polymerization Promoting Protein ELISA kit
E03T0313-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Tubulin Polymerization Promoting Protein ELISA kit
E03T0313-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Tubulin Polymerization Promoting Protein ELISA kit
E02T0313-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Tubulin Polymerization Promoting Protein ELISA kit
E02T0313-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Tubulin Polymerization Promoting Protein ELISA kit
E02T0313-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Tubulin Polymerization Promoting Protein ELISA kit
E04T0313-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Tubulin Polymerization Promoting Protein ELISA kit
E04T0313-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Tubulin Polymerization Promoting Protein ELISA kit
E04T0313-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Tubulin Polymerization Promoting Protein ELISA kit
E08T0313-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Tubulin Polymerization Promoting Protein ELISA kit
E08T0313-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Tubulin Polymerization Promoting Protein ELISA kit
E08T0313-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Tubulin Polymerization Promoting Protein ELISA kit
E07T0313-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Tubulin Polymerization Promoting Protein ELISA kit
E07T0313-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Tubulin Polymerization Promoting Protein ELISA kit
E07T0313-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Tubulin Polymerization Promoting Protein ELISA kit
E06T0313-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Tubulin Polymerization Promoting Protein ELISA kit
E06T0313-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Tubulin Polymerization Promoting Protein ELISA kit
E06T0313-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tubulin Polymerization Promoting Protein ELISA kit
E09T0313-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tubulin Polymerization Promoting Protein ELISA kit
E09T0313-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tubulin Polymerization Promoting Protein ELISA kit
E09T0313-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Tubulin Polymerization Promoting Protein ELISA kit
E05T0313-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Tubulin Polymerization Promoting Protein ELISA kit
E05T0313-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Tubulin Polymerization Promoting Protein ELISA kit
E05T0313-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Tubulin Polymerization-Promoting Protein Family Member 3 Protein
20-abx261129
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Human Tubulin polymerization-promoting protein family member 2 (TPPP2) ELISA Kit
abx383882-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Tubulin polymerization-promoting protein family member 3 (TPPP3) ELISA Kit
abx383883-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-100ug
QP6830-ec-100ug 100ug
EUR 408
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-10ug
QP6830-ec-10ug 10ug
EUR 200
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-1mg
QP6830-ec-1mg 1mg
EUR 1632
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-200ug
QP6830-ec-200ug 200ug
EUR 634
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-500ug
QP6830-ec-500ug 500ug
EUR 1060
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-50ug
QP6830-ec-50ug 50ug
EUR 263
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody
20-abx116341
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody
20-abx116342
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody
20-abx141911
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody
abx145332-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody
abx145333-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody
20-abx005197
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody
20-abx305765
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody
20-abx318549
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody
abx238899-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody
abx238900-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
TPPP3 Tubulin Polymerization-Promoting Protein Family Member 3 Human Recombinant Protein
PROTQ9BW30 Regular: 20ug
EUR 317
Description: TPPP3 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 199 amino acids (1-176) and having a molecular mass of 21.4kDa.
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody (HRP)
20-abx305762
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody (FITC)
20-abx305763
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody (Biotin)
20-abx305764
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody (HRP)
20-abx305766
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody (FITC)
20-abx305767
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody (Biotin)
20-abx305768
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human TPPP ELISA Kit
EHT0320 96Tests
EUR 521
TPPP ELISA KIT|Human
EF007225 96 Tests
EUR 689
TPPP ELISA Kit (Human) (OKCD01559)
OKCD01559 96 Wells
EUR 792
Description: Description of target: May play a role in the polymerization of tubulin into microtubules, microtubule bundling and the stabilization of existing microtubules, thus maintaining the integrity of the microtubule network. May play a role in mitotic spindle assembly and nuclear envelope breakdown.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.128 ng/mL
Goat TPPP ELISA Kit
EGTT0320 96Tests
EUR 521
Bovine TPPP ELISA Kit
EBT0320 96Tests
EUR 521
Chicken TPPP ELISA Kit
ECKT0320 96Tests
EUR 521
Anserini TPPP ELISA Kit
EAT0320 96Tests
EUR 521
Canine TPPP ELISA Kit
ECT0320 96Tests
EUR 521
Porcine TPPP ELISA Kit
EPT0320 96Tests
EUR 521
Rat TPPP ELISA Kit
ERT0320 96Tests
EUR 521
Sheep TPPP ELISA Kit
EST0320 96Tests
EUR 521
Rabbit TPPP ELISA Kit
ERTT0320 96Tests
EUR 521
Monkey TPPP ELISA Kit
EMKT0320 96Tests
EUR 521
Mouse TPPP ELISA Kit
EMT0320 96Tests
EUR 521
TPPP Recombinant Protein (Human)
RP044413 100 ug Ask for price
Human gamma Tubulin (gamma Tubulin) ELISA Kit
abx259584-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Guinea Pig TPPP ELISA Kit
EGT0320 96Tests
EUR 521
TPPP ELISA Kit (Mouse) (OKCD07044)
OKCD07044 96 Wells
EUR 779
Description: Description of target: This protein was disclosed by the RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full length complementary DNAs and physical mapping of the corresponding genes to the mouse genome.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL
TPPP ELISA Kit (Mouse) (OKDD00629)
OKDD00629 96 Wells
EUR 909
Description: Description of target: May play a role in the polymerization of tubulin into microtubules, microtubule bundling and the stabilization of existing microtubules, thus maintaining the integrity of the microtubule network. may play a role in mitotic spindle assembly and nuclear envelope breakdown.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.053 ng/mL
TPPP ELISA Kit (Rat) (OKEI00871)
OKEI00871 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Human Maturation promoting factor ELISA kit
E01M0264-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Maturation promoting factor ELISA kit
E01M0264-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Maturation promoting factor ELISA kit
E01M0264-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human maturation promoting factor ELISA Kit
ELA-E1351h 96 Tests
EUR 824
TPPP siRNA
20-abx937861
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TPPP siRNA
20-abx937862
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TPPP antibody
70R-20942 50 ul
EUR 435
Description: Rabbit polyclonal TPPP antibody
TPPP Antibody
ABD7880 100 ug
EUR 438
TPPP Antibody
ABD7919 100 ug
EUR 438
TPPP Antibody
42950-100ul 100ul
EUR 252
TPPP antibody
70R-10328 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TPPP antibody
TPPP Antibody
DF7880 200ul
EUR 304
Description: TPPP Antibody detects endogenous levels of total TPPP.
TPPP Antibody
1-CSB-PA024115ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
TPPP Antibody
1-CSB-PA024115GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Human β tubulin ELISA kit
E01T0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human β tubulin ELISA kit
E01T0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human β tubulin ELISA kit
E01T0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Tubulin-beta ELISA KIT|Human
EF003944 96 Tests
EUR 689
gamma Tubulin ELISA KIT|Human
EF009775 96 Tests
EUR 689
alpha Tubulin ELISA KIT|Human
EF007730 96 Tests
EUR 689
human ?-tubulin,TUBB ELISA kit
201-12-1609 96 tests
EUR 440
  • This ?-tubulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
TPPP Recombinant Protein (Rat)
RP234431 100 ug Ask for price
TPPP Recombinant Protein (Mouse)
RP180746 100 ug Ask for price
Human TPPP shRNA Plasmid
20-abx957573
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Maturation Promoting Factor (MPF) ELISA Kit
abx354414-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Human maturation promoting factor,MPF ELISA Kit
201-12-0664 96 tests
EUR 440
  • This maturation promoting factor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human maturation promoting factor,MPF ELISA Kit
CN-03525H1 96T
EUR 442
Human maturation promoting factor,MPF ELISA Kit
CN-03525H2 48T
EUR 293
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Human Tubulin Beta (TUBB) ELISA Kit
abx570283-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Tubulin Alpha 3c ELISA kit
E01T0366-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tubulin Alpha 3c ELISA kit
E01T0366-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tubulin Alpha 3c ELISA kit
E01T0366-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Acetylated tubulin Lys40 ELISA KIT|Human
EF007566 96 Tests
EUR 689
Human β-tubulin(TUBB)ELISA Kit
GA-E1625HM-48T 48T
EUR 289
Human β-tubulin(TUBB)ELISA Kit
GA-E1625HM-96T 96T
EUR 466
Human Tubulin Beta (TUBB) ELISA Kit
abx251297-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Tubulin Beta (TUBb) ELISA Kit
DLR-TUBb-Hu-48T 48T
EUR 498
  • Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Tubulin Beta (TUBb) ELISA Kit
DLR-TUBb-Hu-96T 96T
EUR 647
  • Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
ELISA kit for Human TUB? (?-Tubulin)
E-EL-H1006 1 plate of 96 wells
EUR 534
  • Gentaur's TUB? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TUB?. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TUB? (?-Tubulin) in samples from Serum, Plasma, Cell supernatant
Human Tubulin Beta (TUBb) ELISA Kit
RDR-TUBb-Hu-48Tests 48 Tests
EUR 522
Human Tubulin Beta (TUBb) ELISA Kit
RDR-TUBb-Hu-96Tests 96 Tests
EUR 724
Human Tubulin Beta (TUBb) ELISA Kit
RD-TUBb-Hu-48Tests 48 Tests
EUR 500
Human Tubulin Beta (TUBb) ELISA Kit
RD-TUBb-Hu-96Tests 96 Tests
EUR 692
Human Tubulin Epsilon(TUBe)ELISA Kit
QY-E01093 96T
EUR 361
Human Tubulin Delta(TUBd)ELISA Kit
QY-E01094 96T
EUR 361
Human Tubulin Beta(TUBb)ELISA Kit
QY-E01101 96T
EUR 361
Human β-tubulin(TUBB)ELISA Kit
QY-E04395 96T
EUR 361
Rat Maturation promoting factor ELISA kit
E02M0264-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Maturation promoting factor ELISA kit
E02M0264-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Maturation promoting factor ELISA kit
E02M0264-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Maturation promoting factor ELISA kit
E03M0264-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Maturation promoting factor ELISA kit
E03M0264-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Maturation promoting factor ELISA kit
E03M0264-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Maturation promoting factor ELISA kit
E04M0264-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Maturation promoting factor ELISA kit
E04M0264-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Maturation promoting factor ELISA kit
E04M0264-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Maturation promoting factor ELISA kit
E08M0264-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Maturation promoting factor ELISA kit
E08M0264-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Maturation promoting factor ELISA kit
E08M0264-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Maturation promoting factor ELISA kit
E07M0264-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Maturation promoting factor ELISA kit
E07M0264-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Maturation promoting factor ELISA kit
E07M0264-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Maturation promoting factor ELISA kit
E06M0264-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Maturation promoting factor ELISA kit
E06M0264-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Maturation promoting factor ELISA kit
E06M0264-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Maturation promoting factor ELISA kit
E09M0264-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Maturation promoting factor ELISA kit
E09M0264-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Maturation promoting factor ELISA kit
E09M0264-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
TPPP Conjugated Antibody
C42950 100ul
EUR 397
TPPP cloning plasmid
CSB-CL024115HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: ATGGCTGACAAGGCCAAGCCTGCCAAAGCTGCCAACAGGACGCCCCCCAAGTCCCCGGGGGACCCCTCGAAGGACCGGGCAGCCAAGAGGCTGTCGCTGGAATCGGAGGGTGCTGGTGAGGGGGCAGCCGCATCCCCTGAGCTCAGTGCCCTGGAGGAGGCCTTCCGGCGCTTTGC
  • Show more
Description: A cloning plasmid for the TPPP gene.
anti- TPPP antibody
FNab08897 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: tubulin polymerization promoting protein
  • Uniprot ID: O94811
  • Gene ID: 11076
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against TPPP
anti- TPPP antibody
FNab08898 100µg
EUR 585
  • Immunogen: tubulin polymerization promoting protein
  • Uniprot ID: O94811
  • Gene ID: 11076
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against TPPP
TPPP Polyclonal Antibody
ES8985-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TPPP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TPPP Polyclonal Antibody
ES8985-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TPPP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TPPP Polyclonal Antibody
ABP60742-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPPP from Human, Mouse. This TPPP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
TPPP Polyclonal Antibody
ABP60742-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPPP from Human, Mouse. This TPPP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
TPPP Polyclonal Antibody
ABP60742-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TPPP from Human, Mouse. This TPPP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
TPPP (pS18) Antibody
abx219079-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
TPPP Rabbit mAb
A4637-100ul 100 ul
EUR 410
TPPP Rabbit mAb
A4637-200ul 200 ul
EUR 571
TPPP Rabbit mAb
A4637-20ul 20 ul
EUR 221

Human TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit