Human TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit
Human TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
DLR-TPPP-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RDR-TPPP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RDR-TPPP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RD-TPPP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RD-TPPP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
DLR-TPPP-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids. |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
DLR-TPPP-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates or other biological fluids. |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RDR-TPPP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RDR-TPPP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RD-TPPP-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
RD-TPPP-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Human Tubulin polymerization-promoting protein (TPPP) |
1-CSB-EP024115HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 50.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Tubulin polymerization-promoting protein(TPPP) expressed in E.coli |
Tubulin Polymerization Promoting Protein (TPPP) Protein |
20-abx262669 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx123553 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx116340 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx104140 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1094.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
abx029266-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
abx029266-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx174961 |
Abbexa |
|
|
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx322624 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
abx430016-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
abx238897-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
abx238898-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx178749 |
Abbexa |
|
|
|
Tubulin Polymerization Promoting Protein (TPPP) Antibody |
20-abx178750 |
Abbexa |
|
|
|
Recombinant Tubulin Polymerization Promoting Protein (TPPP) |
4-RPA993Hu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O94811
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.8kDa
- Isoelectric Point: 9.5
|
Description: Recombinant Human Tubulin Polymerization Promoting Protein expressed in: E.coli |
Human TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit |
EH3905 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: O94811
- Alias: TPPP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
Human Tubulin polymerization- promoting protein, TPPP ELISA KIT |
ELI-45590h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
20-abx153365 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx253305-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
SEA993Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in tissue homogenates, cell lysates and other biological fluids. |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
SEA993Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in tissue homogenates, cell lysates and other biological fluids. |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
SEA993Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in tissue homogenates, cell lysates and other biological fluids. |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
SEA993Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in tissue homogenates, cell lysates and other biological fluids. |
Human Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
4-SEA993Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Tubulin Polymerization Promoting Protein elisa. Alternative names of the recognized antigen: TPPP1
- p25alpha
- p25
- TPPP/p25
- Brain Specific Protein p25 Alpha
- 25 kDa brain-specific protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tubulin Polymerization Promoting Protein (TPPP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Tubulin Polymerization Promoting Protein ELISA Kit (TPPP) |
RK02438 |
Abclonal |
96 Tests |
EUR 521 |
Human Tubulin Polymerization Promoting Protein(TPPP)ELISA Kit |
QY-E03958 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Tubulin Polymerization Promoting Protein (TPPP) Protein |
20-abx069525 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pig Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx361306-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx362823-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx364178-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Bovine Tubulin polymerization- promoting protein, TPPP ELISA KIT |
ELI-17189b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Tubulin polymerization- promoting protein, Tppp ELISA KIT |
ELI-36678m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit |
EM1421 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q7TQD2
- Alias: TPPP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
20-abx154797 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx353997-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Chicken Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx356474-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx359495-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx254480-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
SEA993Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in Tissue homogenates and other biological fluids. |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
SEA993Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in Tissue homogenates and other biological fluids. |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
SEA993Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in Tissue homogenates and other biological fluids. |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
SEA993Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Polymerization Promoting Protein (TPPP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- I
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in Tissue homogenates and other biological fluids. |
Mouse Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
4-SEA993Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Tubulin Polymerization Promoting Protein elisa. Alternative names of the recognized antigen: TPPP1
- p25alpha
- p25
- TPPP/p25
- Brain Specific Protein p25 Alpha
- 25 kDa brain-specific protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Tubulin Polymerization Promoting Protein (TPPP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Tubulin Polymerization Promoting Protein(TPPP)ELISA Kit |
QY-E10112 |
Qayee Biotechnology |
96T |
EUR 361 |
Mouse Tubulin Polymerization Promoting Protein(TPPP)ELISA Kit |
QY-E21535 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Tubulin Polymerization Promoting Protein (TPPP) CLIA Kit |
20-abx492302 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Tubulin Polymerization Promoting Protein (TPPP) Protein |
20-abx655371 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Tubulin Polymerization Promoting Protein (TPPP) Protein |
20-abx655372 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
ELISA kit for Human TPPP (Tubulin Polymerization Promoting Protein) |
E-EL-H2031 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TPPP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPPP. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human TPPP (Tubulin Polymerization Promoting Protein) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human TPPP (Tubulin Polymerization Promoting Protein) |
ELK4628 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tubulin Polymerization Promoting Protein (TPPP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibod
- Show more
|
Description: A sandwich ELISA kit for detection of Tubulin Polymerization Promoting Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Tubulin polymerization-promoting protein (TPPP) |
KTE60144-48T |
Abbkine |
48T |
EUR 332 |
- Seki et al. (1999) cloned p25 from a neuroblastoma cDNA library. The deduced 219-amino acid protein has a calculated molecular mass of about 24 kD. Human and bovine p25 share 90% amino acid identity. In contrast to the brain-specific expression of bo
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tubulin polymerization-promoting protein (TPPP) |
KTE60144-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Seki et al. (1999) cloned p25 from a neuroblastoma cDNA library. The deduced 219-amino acid protein has a calculated molecular mass of about 24 kD. Human and bovine p25 share 90% amino acid identity. In contrast to the brain-specific expression of bo
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tubulin polymerization-promoting protein (TPPP) |
KTE60144-96T |
Abbkine |
96T |
EUR 539 |
- Seki et al. (1999) cloned p25 from a neuroblastoma cDNA library. The deduced 219-amino acid protein has a calculated molecular mass of about 24 kD. Human and bovine p25 share 90% amino acid identity. In contrast to the brain-specific expression of bo
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
TPPP Tubulin Polymerization Promoting Protein Human Recombinant Protein |
PROTO94811 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: TPPP Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 229 amino acids including a 10 a.a N-terminal His tag. The total molecular mass is 24.9kDa (calculated). |
Mouse Tubulin Polymerization Promoting Protein (TPPP) CLIA Kit |
20-abx492303 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
TPPP ELISA Kit| Mouse Tubulin Polymerization Promoting Protein E |
EF013945 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Mouse TPPP (Tubulin Polymerization Promoting Protein) |
ELK2645 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tubulin Polymerization Promoting Protein (TPPP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibod
- Show more
|
Description: A sandwich ELISA kit for detection of Tubulin Polymerization Promoting Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig Tubulin Polymerization Promoting Protein (TPPP) ELISA Kit |
abx357445-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse TPPP (Tubulin Polymerization Promoting Protein) |
E-EL-M1209 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TPPP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse TPPP. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse TPPP (Tubulin Polymerization Promoting Protein) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat TPPP (Tubulin Polymerization Promoting Protein) |
E-EL-R1034 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TPPP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat TPPP. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat TPPP (Tubulin Polymerization Promoting Protein) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Mouse Tubulin polymerization-promoting protein (TPPP) |
KTE70063-48T |
Abbkine |
48T |
EUR 332 |
- The novel basic, heat-stable tubulin polymerization promoting protein TPPP/p25 is associated with microtubules in vitro and can induce the formation of aberrant microtubule assemblies.
Immunohistochemistry and confocal microscopy demonstrates that TP
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tubulin polymerization-promoting protein (TPPP) |
KTE70063-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The novel basic, heat-stable tubulin polymerization promoting protein TPPP/p25 is associated with microtubules in vitro and can induce the formation of aberrant microtubule assemblies.
Immunohistochemistry and confocal microscopy demonstrates that TP
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tubulin polymerization-promoting protein (TPPP) |
KTE70063-96T |
Abbkine |
96T |
EUR 539 |
- The novel basic, heat-stable tubulin polymerization promoting protein TPPP/p25 is associated with microtubules in vitro and can induce the formation of aberrant microtubule assemblies.
Immunohistochemistry and confocal microscopy demonstrates that TP
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tubulin polymerization-promoting protein (TPPP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse) |
4-PAA993Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2272.00
-
EUR 571.00
-
EUR 288.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP) |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), APC |
4-PAA993Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2951.00
-
EUR 831.00
-
EUR 407.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with APC. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAA993Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2222.00
-
EUR 668.00
-
EUR 357.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Biotin. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAA993Hu01-Cy3 |
Cloud-Clone |
-
EUR 389.00
-
EUR 3893.00
-
EUR 1067.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with Cy3. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), FITC |
4-PAA993Hu01-FITC |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with FITC. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), HRP |
4-PAA993Hu01-HRP |
Cloud-Clone |
-
EUR 296.00
-
EUR 2574.00
-
EUR 737.00
-
EUR 369.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with HRP. |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), PE |
4-PAA993Hu01-PE |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with PE. |
Human Tubulin Polymerization Promoting Protein ELISA kit |
E01T0313-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tubulin Polymerization Promoting Protein ELISA kit |
E01T0313-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tubulin Polymerization Promoting Protein ELISA kit |
E01T0313-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
anti-Tubulin Polymerization Promoting Protein |
YF-PA17418 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Tubulin Polymerization Promoting Protein |
Tubulin Polymerization Promoting Protein (TPPP) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAA993Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 526.00
-
EUR 5782.00
-
EUR 1543.00
-
EUR 695.00
-
EUR 299.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPPP (Ala8~Thr210)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Tubulin Polymerization Promoting Protein (TPPP). This antibody is labeled with APC-Cy7. |
Mouse Tubulin Polymerization Promoting Protein ELISA kit |
E03T0313-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Tubulin Polymerization Promoting Protein ELISA kit |
E03T0313-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Tubulin Polymerization Promoting Protein ELISA kit |
E03T0313-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tubulin Polymerization Promoting Protein ELISA kit |
E02T0313-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tubulin Polymerization Promoting Protein ELISA kit |
E02T0313-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tubulin Polymerization Promoting Protein ELISA kit |
E02T0313-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Tubulin Polymerization Promoting Protein ELISA kit |
E04T0313-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Tubulin Polymerization Promoting Protein ELISA kit |
E04T0313-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Tubulin Polymerization Promoting Protein ELISA kit |
E04T0313-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Tubulin Polymerization Promoting Protein ELISA kit |
E08T0313-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Tubulin Polymerization Promoting Protein ELISA kit |
E08T0313-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Tubulin Polymerization Promoting Protein ELISA kit |
E08T0313-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Tubulin Polymerization Promoting Protein ELISA kit |
E07T0313-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Tubulin Polymerization Promoting Protein ELISA kit |
E07T0313-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Tubulin Polymerization Promoting Protein ELISA kit |
E07T0313-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Tubulin Polymerization Promoting Protein ELISA kit |
E06T0313-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Tubulin Polymerization Promoting Protein ELISA kit |
E06T0313-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Tubulin Polymerization Promoting Protein ELISA kit |
E06T0313-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Tubulin Polymerization Promoting Protein ELISA kit |
E09T0313-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Tubulin Polymerization Promoting Protein ELISA kit |
E09T0313-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Tubulin Polymerization Promoting Protein ELISA kit |
E09T0313-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Tubulin Polymerization Promoting Protein ELISA kit |
E05T0313-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Tubulin Polymerization Promoting Protein ELISA kit |
E05T0313-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Tubulin Polymerization Promoting Protein ELISA kit |
E05T0313-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Tubulin Polymerization Promoting Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Tubulin Polymerization-Promoting Protein Family Member 3 Protein |
20-abx261129 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human Tubulin polymerization-promoting protein family member 2 (TPPP2) ELISA Kit |
abx383882-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Tubulin polymerization-promoting protein family member 3 (TPPP3) ELISA Kit |
abx383883-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-100ug |
QP6830-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-10ug |
QP6830-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-1mg |
QP6830-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-200ug |
QP6830-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-500ug |
QP6830-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human Tubulin polymerization-promoting protein Protein, GST, E.coli-50ug |
QP6830-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody |
20-abx116341 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody |
20-abx116342 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody |
20-abx141911 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody |
abx145332-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody |
abx145333-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody |
20-abx005197 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody |
20-abx305765 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody |
20-abx318549 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody |
abx238899-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody |
abx238900-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
TPPP3 Tubulin Polymerization-Promoting Protein Family Member 3 Human Recombinant Protein |
PROTQ9BW30 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: TPPP3 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 199 amino acids (1-176) and having a molecular mass of 21.4kDa. |
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody (HRP) |
20-abx305762 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody (FITC) |
20-abx305763 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 2 (TPPP2) Antibody (Biotin) |
20-abx305764 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody (HRP) |
20-abx305766 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody (FITC) |
20-abx305767 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tubulin Polymerization-Promoting Protein Family Member 3 (TPPP3) Antibody (Biotin) |
20-abx305768 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human TPPP ELISA Kit |
EHT0320 |
Abclonal |
96Tests |
EUR 521 |
TPPP ELISA Kit (Human) (OKCD01559) |
OKCD01559 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: May play a role in the polymerization of tubulin into microtubules, microtubule bundling and the stabilization of existing microtubules, thus maintaining the integrity of the microtubule network. May play a role in mitotic spindle assembly and nuclear envelope breakdown.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.128 ng/mL |
Goat TPPP ELISA Kit |
EGTT0320 |
Abclonal |
96Tests |
EUR 521 |
Bovine TPPP ELISA Kit |
EBT0320 |
Abclonal |
96Tests |
EUR 521 |
Chicken TPPP ELISA Kit |
ECKT0320 |
Abclonal |
96Tests |
EUR 521 |
Anserini TPPP ELISA Kit |
EAT0320 |
Abclonal |
96Tests |
EUR 521 |
Canine TPPP ELISA Kit |
ECT0320 |
Abclonal |
96Tests |
EUR 521 |
Porcine TPPP ELISA Kit |
EPT0320 |
Abclonal |
96Tests |
EUR 521 |
Rat TPPP ELISA Kit |
ERT0320 |
Abclonal |
96Tests |
EUR 521 |
Sheep TPPP ELISA Kit |
EST0320 |
Abclonal |
96Tests |
EUR 521 |
Rabbit TPPP ELISA Kit |
ERTT0320 |
Abclonal |
96Tests |
EUR 521 |
Monkey TPPP ELISA Kit |
EMKT0320 |
Abclonal |
96Tests |
EUR 521 |
Mouse TPPP ELISA Kit |
EMT0320 |
Abclonal |
96Tests |
EUR 521 |
TPPP Recombinant Protein (Human) |
RP044413 |
ABM |
100 ug |
Ask for price |
Human gamma Tubulin (gamma Tubulin) ELISA Kit |
abx259584-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Guinea Pig TPPP ELISA Kit |
EGT0320 |
Abclonal |
96Tests |
EUR 521 |
TPPP ELISA Kit (Mouse) (OKCD07044) |
OKCD07044 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: This protein was disclosed by the RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full length complementary DNAs and physical mapping of the corresponding genes to the mouse genome.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL |
TPPP ELISA Kit (Mouse) (OKDD00629) |
OKDD00629 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: May play a role in the polymerization of tubulin into microtubules, microtubule bundling and the stabilization of existing microtubules, thus maintaining the integrity of the microtubule network. may play a role in mitotic spindle assembly and nuclear envelope breakdown.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.053 ng/mL |
TPPP ELISA Kit (Rat) (OKEI00871) |
OKEI00871 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Maturation promoting factor ELISA kit |
E01M0264-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Maturation promoting factor ELISA kit |
E01M0264-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Maturation promoting factor ELISA kit |
E01M0264-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human maturation promoting factor ELISA Kit |
ELA-E1351h |
Lifescience Market |
96 Tests |
EUR 824 |
TPPP siRNA |
20-abx937861 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TPPP siRNA |
20-abx937862 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TPPP antibody |
70R-20942 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TPPP antibody |
TPPP Antibody |
42950-100ul |
SAB |
100ul |
EUR 252 |
TPPP antibody |
70R-10328 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal TPPP antibody |
TPPP Antibody |
DF7880 |
Affbiotech |
200ul |
EUR 304 |
Description: TPPP Antibody detects endogenous levels of total TPPP. |
TPPP Antibody |
1-CSB-PA024115ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
TPPP Antibody |
1-CSB-PA024115GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TPPP. Recognizes TPPP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Human β tubulin ELISA kit |
E01T0555-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β tubulin ELISA kit |
E01T0555-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human β tubulin ELISA kit |
E01T0555-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
human ?-tubulin,TUBB ELISA kit |
201-12-1609 |
SunredBio |
96 tests |
EUR 440 |
- This ?-tubulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
TPPP Recombinant Protein (Rat) |
RP234431 |
ABM |
100 ug |
Ask for price |
TPPP Recombinant Protein (Mouse) |
RP180746 |
ABM |
100 ug |
Ask for price |
Human TPPP shRNA Plasmid |
20-abx957573 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Maturation Promoting Factor (MPF) ELISA Kit |
abx354414-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human maturation promoting factor,MPF ELISA Kit |
201-12-0664 |
SunredBio |
96 tests |
EUR 440 |
- This maturation promoting factor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human maturation promoting factor,MPF ELISA Kit |
CN-03525H1 |
ChemNorm |
96T |
EUR 442 |
Human maturation promoting factor,MPF ELISA Kit |
CN-03525H2 |
ChemNorm |
48T |
EUR 293 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human Tubulin Beta (TUBB) ELISA Kit |
abx570283-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Tubulin Alpha 3c ELISA kit |
E01T0366-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tubulin Alpha 3c ELISA kit |
E01T0366-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tubulin Alpha 3c ELISA kit |
E01T0366-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tubulin Beta (TUBB) ELISA Kit |
abx251297-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Tubulin Beta (TUBb) ELISA Kit |
DLR-TUBb-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Tubulin Beta (TUBb) ELISA Kit |
DLR-TUBb-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
ELISA kit for Human TUB? (?-Tubulin) |
E-EL-H1006 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TUB? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TUB?. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human TUB? (?-Tubulin) in samples from Serum, Plasma, Cell supernatant |
Human Tubulin Beta (TUBb) ELISA Kit |
RDR-TUBb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Tubulin Beta (TUBb) ELISA Kit |
RDR-TUBb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Tubulin Beta (TUBb) ELISA Kit |
RD-TUBb-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Tubulin Beta (TUBb) ELISA Kit |
RD-TUBb-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Rat Maturation promoting factor ELISA kit |
E02M0264-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Maturation promoting factor ELISA kit |
E02M0264-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Maturation promoting factor ELISA kit |
E02M0264-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Maturation promoting factor ELISA kit |
E03M0264-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Maturation promoting factor ELISA kit |
E03M0264-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Maturation promoting factor ELISA kit |
E03M0264-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Maturation promoting factor ELISA kit |
E04M0264-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Maturation promoting factor ELISA kit |
E04M0264-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Maturation promoting factor ELISA kit |
E04M0264-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Maturation promoting factor ELISA kit |
E08M0264-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Maturation promoting factor ELISA kit |
E08M0264-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Maturation promoting factor ELISA kit |
E08M0264-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Maturation promoting factor ELISA kit |
E07M0264-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Maturation promoting factor ELISA kit |
E07M0264-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Maturation promoting factor ELISA kit |
E07M0264-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Maturation promoting factor ELISA kit |
E06M0264-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Maturation promoting factor ELISA kit |
E06M0264-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Maturation promoting factor ELISA kit |
E06M0264-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Maturation promoting factor ELISA kit |
E09M0264-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Maturation promoting factor ELISA kit |
E09M0264-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Maturation promoting factor ELISA kit |
E09M0264-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Maturation promoting factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
TPPP Conjugated Antibody |
C42950 |
SAB |
100ul |
EUR 397 |
TPPP cloning plasmid |
CSB-CL024115HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 660
- Sequence: ATGGCTGACAAGGCCAAGCCTGCCAAAGCTGCCAACAGGACGCCCCCCAAGTCCCCGGGGGACCCCTCGAAGGACCGGGCAGCCAAGAGGCTGTCGCTGGAATCGGAGGGTGCTGGTGAGGGGGCAGCCGCATCCCCTGAGCTCAGTGCCCTGGAGGAGGCCTTCCGGCGCTTTGC
- Show more
|
Description: A cloning plasmid for the TPPP gene. |
anti- TPPP antibody |
FNab08897 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: tubulin polymerization promoting protein
- Uniprot ID: O94811
- Gene ID: 11076
- Research Area: Signal Transduction, Developmental biology
|
Description: Antibody raised against TPPP |
anti- TPPP antibody |
FNab08898 |
FN Test |
100µg |
EUR 585 |
- Immunogen: tubulin polymerization promoting protein
- Uniprot ID: O94811
- Gene ID: 11076
- Research Area: Signal Transduction, Developmental biology
|
Description: Antibody raised against TPPP |
TPPP Polyclonal Antibody |
ES8985-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TPPP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TPPP Polyclonal Antibody |
ES8985-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TPPP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TPPP Polyclonal Antibody |
ABP60742-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of TPPP from Human, Mouse. This TPPP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90 |
TPPP Polyclonal Antibody |
ABP60742-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of TPPP from Human, Mouse. This TPPP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90 |
TPPP Polyclonal Antibody |
ABP60742-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of TPPP from Human, Mouse. This TPPP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TPPP protein at amino acid sequence of 10-90 |
TPPP (pS18) Antibody |
abx219079-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
TPPP Rabbit mAb |
A4637-100ul |
Abclonal |
100 ul |
EUR 410 |
TPPP Rabbit mAb |
A4637-200ul |
Abclonal |
200 ul |
EUR 571 |
TPPP Rabbit mAb |
A4637-20ul |
Abclonal |
20 ul |
EUR 221 |
Human TPPP(Tubulin Polymerization Promoting Protein) ELISA Kit