Human TBK1(TANK Binding Kinase 1) ELISA Kit

To Order: Contact us

Human TANK Binding Kinase 1 (TBK1) ELISA Kit
DLR-TBK1-Hu-96T 96T
EUR 673
  • Should the Human TANK Binding Kinase 1 (TBK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human TANK Binding Kinase 1 (TBK1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
RD-TBK1-Hu-48Tests 48 Tests
EUR 521
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
RD-TBK1-Hu-96Tests 96 Tests
EUR 723
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
RDR-TBK1-Hu-48Tests 48 Tests
EUR 544
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
RDR-TBK1-Hu-96Tests 96 Tests
EUR 756
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human TANK Binding Kinase 1 ELISA Kit (TBK1)
RK02365 96 Tests
EUR 521
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
SEH061Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human TANK Binding Kinase 1 (TBK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human TANK Binding Kinase 1 (TBK1) in Tissue homogenates, cell lysates and other biological fluids.
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
SEH061Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human TANK Binding Kinase 1 (TBK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human TANK Binding Kinase 1 (TBK1) in Tissue homogenates, cell lysates and other biological fluids.
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
SEH061Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human TANK Binding Kinase 1 (TBK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human TANK Binding Kinase 1 (TBK1) in Tissue homogenates, cell lysates and other biological fluids.
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
SEH061Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human TANK Binding Kinase 1 (TBK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human TANK Binding Kinase 1 (TBK1) in Tissue homogenates, cell lysates and other biological fluids.
Human TANK Binding Kinase 1 (TBK1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as TANK Binding Kinase 1 elisa. Alternative names of the recognized antigen: NAK
  • T2K
  • NF-kappa-B-activating kinase
  • Serine/threonine-protein kinase TBK1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human TANK Binding Kinase 1 (TBK1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
TANK Binding Kinase 1 (TBK1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
TANK Binding Kinase 1 (TBK1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
TANK Binding Kinase 1 (TBK1) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant TANK Binding Kinase 1 (TBK1)
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UHD2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human TANK Binding Kinase 1 expressed in: E.coli
Mouse TANK Binding Kinase 1 (TBK1) ELISA Kit
abx254931-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human TANK Binding Kinase 1 (TBK1) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human TANK Binding Kinase 1 (TBK1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human TBK1 (TANK Binding Kinase 1)
ELK4375 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to TANK Binding Kinase 1 (TBK1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to TANK
  • Show more
Description: A sandwich ELISA kit for detection of TANK Binding Kinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse TBK1 (TANK Binding Kinase 1)
E-EL-M2672 1 plate of 96 wells
EUR 534
  • Gentaur's TBK1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse TBK1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse TBK1 (TANK Binding Kinase 1) in samples from Serum, Plasma, Cell supernatant
TANK Binding Kinase 1 (TBK1) Polyclonal Antibody (Human, Rat)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBK1 (Trp9~Val310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat TANK Binding Kinase 1 (TBK1)
TANK Binding Kinase 1 (TBK1) Polyclonal Antibody (Human, Rat), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBK1 (Trp9~Val310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat TANK Binding Kinase 1 (TBK1). This antibody is labeled with APC.
TANK Binding Kinase 1 (TBK1) Polyclonal Antibody (Human, Rat), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBK1 (Trp9~Val310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat TANK Binding Kinase 1 (TBK1). This antibody is labeled with Biotin.
TANK Binding Kinase 1 (TBK1) Polyclonal Antibody (Human, Rat), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBK1 (Trp9~Val310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat TANK Binding Kinase 1 (TBK1). This antibody is labeled with Cy3.
TANK Binding Kinase 1 (TBK1) Polyclonal Antibody (Human, Rat), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBK1 (Trp9~Val310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat TANK Binding Kinase 1 (TBK1). This antibody is labeled with FITC.
TANK Binding Kinase 1 (TBK1) Polyclonal Antibody (Human, Rat), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBK1 (Trp9~Val310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat TANK Binding Kinase 1 (TBK1). This antibody is labeled with HRP.
TANK Binding Kinase 1 (TBK1) Polyclonal Antibody (Human, Rat), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBK1 (Trp9~Val310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat TANK Binding Kinase 1 (TBK1). This antibody is labeled with PE.
TANK Binding Kinase 1 (TBK1) Polyclonal Antibody (Human, Rat), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBK1 (Trp9~Val310)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat TANK Binding Kinase 1 (TBK1). This antibody is labeled with APC-Cy7.
Human TANK-binding kinase 1-binding protein 1 (TBKBP1) ELISA Kit
abx385467-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Recombinant human TANK-binding kinase 1-binding protein 1
P2419 100ug Ask for price
  • Uniprot ID: A7MCY6
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human TANK-binding kinase 1-binding protein 1
TANK-Binding Kinase 1 (TBK) Antibody
abx033745-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
TANK-Binding Kinase 1 (TBK) Antibody
abx033745-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tbkbp1 ELISA Kit| Mouse TANK-binding kinase 1-binding protein 1
EF016356 96 Tests
EUR 689
Rat TANK-binding kinase 1-binding protein 1 (TBKBP1) ELISA Kit
abx392045-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse TANK-binding kinase 1-binding protein 1 (TBKBP1) ELISA Kit
abx390713-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
TANK-Binding Kinase 1-Binding Protein 1 (TBKB1) Antibody
abx031457-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
TANK-Binding Kinase 1-Binding Protein 1 (TBKB1) Antibody
abx031457-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
TANK-Binding Kinase 1-Binding Protein 1 (TBKB1) Antibody
abx032476-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
TANK-Binding Kinase 1-Binding Protein 1 (TBKB1) Antibody
abx032476-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tbkbp1 ELISA Kit| Rat TANK-binding kinase 1-binding protein 1 E
EF019405 96 Tests
EUR 689
Human TBK1/ Serine/threonine-protein kinase TBK1 ELISA Kit
E2449Hu 1 Kit
EUR 605
Human Serine/threonine- protein kinase TBK1, TBK1 ELISA KIT
ELI-23763h 96 Tests
EUR 824
Human Serine/threonine-protein kinase TBK1 (TBK1) ELISA Kit
abx572986-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Tbk1/ Serine/threonine-protein kinase TBK1 ELISA Kit
E1442Mo 1 Kit
EUR 632
Mouse Serine/threonine- protein kinase TBK1, Tbk1 ELISA KIT
ELI-18855m 96 Tests
EUR 865
Mouse Serine/threonine-protein kinase TBK1 (TBK1) ELISA Kit
abx516316-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Mouse Tbk1( Serine/threonine-protein kinase TBK1) ELISA Kit
EM0580 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: Q9WUN2
  • Alias: Tbk1/T2K/TANK-binding kinase 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml
Tbk1 ELISA Kit| Mouse Serine/threonine-protein kinase TBK1 ELIS
EF013204 96 Tests
EUR 689
Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase TBK1 (Tbk1) Antibody
abx029446-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase TBK1 (Tbk1) Antibody
abx029446-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody
abx433346-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-TANK Antibody
A00445-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TANK Antibody (TANK) detection.tested for WB in Human, Mouse, Rat.
EF005639 96 Tests
EUR 689
EF005658 96 Tests
EUR 689
ELI-52868h 96 Tests
EUR 824
Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase TBK1 (TBK1) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Human Serine/threonine-protein kinase TBK1
EK3167 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Serine/threonine-protein kinase TBK1 in samples from serum, plasma, tissue homogenates and other biological fluids.
TBK1 ELISA Kit (Human) (OKAN05959)
OKAN05959 96 Wells
EUR 792
Description: Description of target: The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.124 ng/mL
TBK1 ELISA Kit (Human) (OKCD02920)
OKCD02920 96 Wells
EUR 831
Description: Description of target: Serine/threonine kinase that plays an essential role in regulating inflammatory responses to foreign agents. Following activation of toll-like receptors by viral or bacterial components, associates with TRAF3 and TANK and phosphorylates interferon regulatory factors (IRFs) IRF3 and IRF7 as well as DDX3X. This activity allows subsequent homodimerization and nuclear translocation of the IRFs leading to transcriptional activation of pro-inflammatory and antiviral genes including IFNA and IFNB. In order to establish such an antiviral state, TBK1 form several different complexes whose composition depends on the type of cell and cellular stimuli. Thus, several scaffolding molecules including FADD, TRADD, MAVS, AZI2, TANK or TBKBP1/SINTBAD can be recruited to the TBK1-containing-complexes. Under particular conditions, functions as a NF-kappa-B effector by phosphorylating NF-kappa-B inhibitor alpha/NFKBIA, IKBKB or RELA to translocate NF-Kappa-B to the nucleus. Restricts bacterial proliferation by phosphorylating the autophagy receptor OPTN/Optineurin on 'Ser-177', thus enhancing LC3 binding affinity and antibacterial autophagy. Phosphorylates and activates AKT1. Seems to play a role in energy balance regulation by sustaining a state of chronic, low-grade inflammation in obesity, wich leads to a negative impact on insulin sensitivity. Attenuates retroviral budding by phosphorylating the endosomal sorting complex required for transport-I (ESCRT-I) subunit VPS37C. Phosphorylates Borna disease virus (BDV) P protein.1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.124 ng/mL
TBK1 ELISA Kit (Human) (OKEH07181)
OKEH07181 96 Wells
EUR 662
Description: Description of target: Serine/threonine kinase that plays an essential role in regulating inflammatory responses to foreign agents. Following activation of toll-like receptors by viral or bacterial components, associates with TRAF3 and TANK and phosphorylates interferon regulatory factors (IRFs) IRF3 and IRF7 as well as DDX3X. This activity allows subsequent homodimerization and nuclear translocation of the IRFs leading to transcriptional activation of pro-inflammatory and antiviral genes including IFNA and IFNB. In order to establish such an antiviral state, TBK1 form several different complexes whose composition depends on the type of cell and cellular stimuli. Thus, several scaffolding molecules including FADD, TRADD, MAVS, AZI2, TANK or TBKBP1/SINTBAD can be recruited to the TBK1-containing-complexes. Under particular conditions, functions as a NF-kappa-B effector by phosphorylating NF-kappa-B inhibitor alpha/NFKBIA, IKBKB or RELA to translocate NF-Kappa-B to the nucleus. Restricts bacterial proliferation by phosphorylating the autophagy receptor OPTN/Optineurin on 'Ser-177', thus enhancing LC3 binding affinity and antibacterial autophagy. Phosphorylates SMCR8 component of the C9orf72-SMCR8 complex, promoting autophagosome maturation. Phosphorylates and activates AKT1. Seems to play a role in energy balance regulation by sustaining a state of chronic, low-grade inflammation in obesity, wich leads to a negative impact on insulin sensitivity. Attenuates retroviral budding by phosphorylating the endosomal sorting complex required for transport-I (ESCRT-I) subunit VPS37C. Phosphorylates Borna disease virus (BDV) P protein.2;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL
Mouse Tank ELISA KIT
ELI-18835m 96 Tests
EUR 865
ELISA kit for Mouse Serine/threonine-protein kinase TBK1
EK3166 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Serine/threonine-protein kinase TBK1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Recombinant human Serine/threonine-protein kinase TBK1
P1552 100ug Ask for price
  • Uniprot ID: Q9UHD2
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Serine/threonine-protein kinase TBK1
TANK TRAF Family Member-Associated NFKB Activator Human Recombinant Protein
PROTQ92844-1 Regular: 20ug
EUR 317
Description: TANK Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 448 amino acids (1-425a.a) and having a molecular mass of 50.2kDa. TANK is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Serine / threonine-protein kinase TBK1 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Serine / threonine-protein kinase TBK1 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Serine / threonine-protein kinase TBK1 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
ER1005-1 96 Well Plate
EUR 417
Human Retinol-Binding Protein (RBP) AssayMax ELISA Kit
ER2005-1 96 Well Plate
EUR 396
TBK1 Antibody
32724-100ul 100ul
EUR 252
TBK1 Antibody
DF7026 200ul
EUR 304
Description: TBK1 Antibody detects endogenous levels of total TBK1.
TBK1 antibody
70R-5732 50 ug
EUR 467
Description: Rabbit polyclonal TBK1 antibody raised against the N terminal of TBK1
TBK1 antibody
70R-5838 50 ug
EUR 467
Description: Rabbit polyclonal TBK1 antibody raised against the middle region of TBK1
TBK1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBK1. Recognizes TBK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500
TBK1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TBK1. Recognizes TBK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBK1 Antibody
ABD7026 100 ug
EUR 438
PVT12959 2 ug
EUR 391
TANK protein
30R-1306 100 ug
EUR 278
Description: Purified recombinant Human TANK protein
TANK Antibody
24437-100ul 100ul
EUR 390
TANK Antibody
24438-100ul 100ul
EUR 390
TANK antibody
70R-11764 100 ug
EUR 403
Description: Rabbit polyclonal TANK antibody
TANK Antibody
EUR 316
TANK Antibody
EUR 146
TANK antibody
39161-100ul 100ul
EUR 252
TANK Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TANK. Recognizes TANK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
TANK antibody
70R-8257 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TANK antibody
TANK antibody
70R-8258 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TANK antibody
TANK antibody
70R-51696 100 ul
EUR 244
Description: Purified Polyclonal TANK antibody
TANK Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TANK. Recognizes TANK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA16651 50 ul
EUR 363
Description: Mouse polyclonal to TANK
YF-PA16652 50 ul
EUR 363
Description: Mouse polyclonal to TANK
YF-PA16653 100 ug
EUR 403
Description: Rabbit polyclonal to TANK
YF-PA25454 50 ul
EUR 334
Description: Mouse polyclonal to TANK
Human Protein kinase C- binding protein 1, ZMYND8 ELISA KIT
ELI-21015h 96 Tests
EUR 824
Human Protein kinase C-binding protein 1 (ZMYND8) ELISA Kit
abx384413-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Complement C4-Binding Protein (C4BP) AssayMax ELISA Kit
EC2202-1 96 Well Plate
EUR 417
Human Retinol-Binding Protein 4 (RBP4) AssayMax ELISA Kit
ER3005-1 96 Well Plate
EUR 396
Human TBK1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Adenylate Kinase 4 (AK 4) AssayMax ELISA Kit
EA2501-1 96 Well Plate
EUR 477
Human Nucleoside Diphosphate Kinase D (NDPKD) AssayMax ELISA Kit
EN2010-1 96 Well Plate
EUR 417
Human TANK shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TANK Recombinant Protein (Human)
RP030904 100 ug Ask for price
TANK Recombinant Protein (Human)
RP030907 100 ug Ask for price
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
TBK1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2342802 1.0 ug DNA
EUR 154
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
TBK1 ELISA Kit (Mouse) : 96 Wells (OKEH02286)
OKEH02286 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.7 pg/mL
TANK sgRNA CRISPR Lentivector (Human) (Target 1)
K2331202 1.0 ug DNA
EUR 154
Human Fatty Acid-Binding Protein 4 (FABP4) AssayMax ELISA Kit
EF2702-1 96 Well Plate
EUR 417
Human Fatty Acid-Binding Protein 5 (FABP5) AssayMax ELISA Kit
EF2705-1 96 Well Plate
EUR 417
Human p21-Activated Kinase 4 (PAK-4) AssayMax ELISA Kit
EP3201-1 96 Well Plate
EUR 477
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
Human Mitogen Activated Protein Kinase Binding Protein 1 (MAPKBP1) ELISA Kit
abx388425-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
GUK1 Human, Guanylate Kinase 1 Human Recombinant Protein, Active
PROTQ16774-1 Regular: 10ug
EUR 317
Description: GUK1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 217 amino acids (1-197 a.a.)and having a total molecular mass of 23.9 kDa. ;GUK1 is fused to a 20 amino acid His Tag at N-terminus and is purified by proprietary chromatographic techniques.
NAK / TBK1 Antibody
48319-100ul 100ul
EUR 333
NAK / TBK1 Antibody
48319-50ul 50ul
EUR 239
TBK1 Rabbit pAb
A14641-100ul 100 ul
EUR 308
TBK1 Rabbit pAb
A14641-200ul 200 ul
EUR 459
TBK1 Rabbit pAb
A14641-20ul 20 ul
EUR 183
TBK1 Rabbit pAb
A14641-50ul 50 ul
EUR 223
TBK1 Blocking Peptide
33R-2352 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBK1 antibody, catalog no. 70R-5732
TBK1 Blocking Peptide
33R-7524 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TBK1 antibody, catalog no. 70R-5838
TBK1 Blocking Peptide
DF7026-BP 1mg
EUR 195
TBK1 (pS172) Antibody
abx218904-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
TBK1 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
TBK1 Conjugated Antibody
C32724 100ul
EUR 397
TBK1 cloning plasmid
CSB-CL890690HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2190
  • Sequence: atgcagagcacttctaatcatctgtggcttttatctgatattttaggccaaggagctactgcaaatgtctttcgtggaagacataagaaaactggtgatttatttgctatcaaagtatttaataacataagcttccttcgtccagtggatgttcaaatgagagaatttgaagtgt
  • Show more
Description: A cloning plasmid for the TBK1 gene.
TBK1 Polyclonal Antibody
ABP54674-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human TBK1 around the non-phosphorylation site of S172
  • Applications tips:
Description: A polyclonal antibody for detection of TBK1 from Human, Mouse. This TBK1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TBK1 around the non-phosphorylation site of S172
TBK1 Polyclonal Antibody
ABP54674-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human TBK1 around the non-phosphorylation site of S172
  • Applications tips:
Description: A polyclonal antibody for detection of TBK1 from Human, Mouse. This TBK1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TBK1 around the non-phosphorylation site of S172
TBK1 Polyclonal Antibody
ABP54674-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human TBK1 around the non-phosphorylation site of S172
  • Applications tips:
Description: A polyclonal antibody for detection of TBK1 from Human, Mouse. This TBK1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TBK1 around the non-phosphorylation site of S172
TBK1 Rabbit pAb
A2573-100ul 100 ul
EUR 308
TBK1 Rabbit pAb
A2573-200ul 200 ul
EUR 459
TBK1 Rabbit pAb
A2573-20ul 20 ul
EUR 183
TBK1 Rabbit pAb
A2573-50ul 50 ul
EUR 223
TBK1 Polyclonal Antibody
ES5673-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBK1 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA
TBK1 Polyclonal Antibody
ES5673-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBK1 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA
PVT19162 2 ug
EUR 300
Anti-TBK1 antibody
STJ25781 100 µl
EUR 277
Description: The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors.
Anti-TBK1 antibody
STJ116848 100 µl
EUR 277
Description: The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors.
Anti-TBK1 antibody
STJ95926 200 µl
EUR 197
Description: Rabbit polyclonal to TBK1.
Anti-TBK1 Antibody
STJ503212 100 µg
EUR 476
CDK1 Cyclin-Dependent Kinase 1 Human Recombinant Protein
PROTP06493-1 Regular: 20ug
EUR 317
Description: CDK1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 317 amino acids (1-297 a.a) and having a molecular mass of 36.2kDa. CDK1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
EG3801-1 96 Well Plate
EUR 396
Human Gc-Globulin (Vitamin D-binding Protein, DBP) AssayMax ELISA Kit
EG3811-1 96 Well Plate
EUR 417
TANK Rabbit pAb
A14501-100ul 100 ul
EUR 308
TANK Rabbit pAb
A14501-200ul 200 ul
EUR 459
TANK Rabbit pAb
A14501-20ul 20 ul
EUR 183
TANK Rabbit pAb
A14501-50ul 50 ul
EUR 223
TANK Blocking Peptide
33R-2027 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TANK antibody, catalog no. 70R-8258
TANK Blocking Peptide
33R-4584 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TANK antibody, catalog no. 70R-8257
TANK Blocking Peptide
EUR 153
TANK Blocking Peptide
33R-10718 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TANK antibody, catalog no. 70R-11764
Polyclonal TANK Antibody
APR00075G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TANK . This antibody is tested and proven to work in the following applications:
Anti-TANK Antibody
A00445-3 100ug/vial
EUR 334
91-300-20 1/pk
EUR 121
Description: Flexible Containers; Bioprocess Bags and Parts
91-300-30 1/pk
EUR 124
Description: Flexible Containers; Bioprocess Bags and Parts
91-300-80 1/pk
EUR 97
Description: Flexible Containers; Bioprocess Bags and Parts
TANK Conjugated Antibody
C39161 100ul
EUR 397
Polyclonal TANK Antibody
APR06416G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TANK . This antibody is tested and proven to work in the following applications:
Polyclonal TANK Antibody
APR06417G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TANK . This antibody is tested and proven to work in the following applications:
TANK cloning plasmid
CSB-CL852916HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 360
  • Sequence: atggataaaaacattggcgagcaactcaataaagcgtatgaagccttccggcaggcatgcatggatagagattctgcagtaaaagaattacagcaaaagactgagaactatgagcagagaatacgtgaacaacaggaacagctgtcacttcaacagactattattgacaagctaaa
  • Show more
Description: A cloning plasmid for the TANK gene.
TANK cloning plasmid
CSB-CL852916HU2-10ug 10ug
EUR 468
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1278
  • Sequence: atggataaaaacattggcgagcaactcaataaagcgtatgaagccttccggcaggcatgcatggatagagattctgcagtaaaagaattacagcaaaagactgagaactatgagcagagaatacgtgaacaacaggaacagctgtcacttcaacagactattattgacaagctaa
  • Show more
Description: A cloning plasmid for the TANK gene.
TANK Polyclonal Antibody
ABP53404-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TANK at AA rangle: 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of TANK from Human, Mouse, Rat. This TANK antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TANK at AA rangle: 140-220
TANK Polyclonal Antibody
ABP53404-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TANK at AA rangle: 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of TANK from Human, Mouse, Rat. This TANK antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TANK at AA rangle: 140-220
TANK Polyclonal Antibody
ABP53404-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TANK at AA rangle: 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of TANK from Human, Mouse, Rat. This TANK antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TANK at AA rangle: 140-220
TANK Rabbit pAb
A6763-100ul 100 ul
EUR 308
TANK Rabbit pAb
A6763-200ul 200 ul
EUR 459
TANK Rabbit pAb
A6763-20ul 20 ul
EUR 183
TANK Rabbit pAb
A6763-50ul 50 ul
EUR 223
TANK Polyclonal Antibody
ES4403-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TANK from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
TANK Polyclonal Antibody
ES4403-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TANK from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
Anti-TANK antibody
STJ28846 100 µl
EUR 277
Description: The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-TANK antibody
STJ116712 100 µl
EUR 277
Description: The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-TANK antibody
STJ95905 200 µl
EUR 197
Description: Rabbit polyclonal to TANK.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Human MAP4K1(MEK Kinase Kinase 1)ELISA Kit
EH9949 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human MEK Kinase Kinase 1 (MAP4K1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
TBK1 ORF Vector (Human) (pORF)
ORF010354 1.0 ug DNA
EUR 95
Antibody for Human TBK1 (pSer172)
SPC-1088D 0.1ml
EUR 354
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is unconjugated.
Antibody for Human TBK1 (pSer172)
SPC-1088D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 390.
Antibody for Human TBK1 (pSer172)
SPC-1088D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 488.
Antibody for Human TBK1 (pSer172)
SPC-1088D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 565.
Antibody for Human TBK1 (pSer172)
SPC-1088D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 594.
Antibody for Human TBK1 (pSer172)
SPC-1088D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 633.
Antibody for Human TBK1 (pSer172)
SPC-1088D-A655 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 655.
Antibody for Human TBK1 (pSer172)
SPC-1088D-A680 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 680.
Antibody for Human TBK1 (pSer172)
SPC-1088D-A700 0.1ml
EUR 400
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to ATTO 700.
Antibody for Human TBK1 (pSer172)
SPC-1088D-ALP 0.1ml
EUR 394
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to Alkaline Phosphatase.
Antibody for Human TBK1 (pSer172)
SPC-1088D-APC 0.1ml
EUR 399
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to APC .
Antibody for Human TBK1 (pSer172)
SPC-1088D-APCCY7 0.1ml
EUR 471
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to APC/Cy7.
Antibody for Human TBK1 (pSer172)
SPC-1088D-BI 0.1ml
EUR 396
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to Biotin.
Antibody for Human TBK1 (pSer172)
SPC-1088D-DY350 0.1ml
EUR 475
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to Dylight 350.
Antibody for Human TBK1 (pSer172)
SPC-1088D-DY405 0.1ml
EUR 452
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to Dylight 405.
Antibody for Human TBK1 (pSer172)
SPC-1088D-DY488 0.1ml
EUR 432
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to Dylight 488.
Antibody for Human TBK1 (pSer172)
SPC-1088D-DY594 0.1ml
EUR 436
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to Dylight 594.
Antibody for Human TBK1 (pSer172)
SPC-1088D-DY633 0.1ml
EUR 426
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to Dylight 633.
Antibody for Human TBK1 (pSer172)
SPC-1088D-FITC 0.1ml
EUR 392
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to FITC.
Antibody for Human TBK1 (pSer172)
SPC-1088D-HRP 0.1ml
EUR 388
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to HRP.
Antibody for Human TBK1 (pSer172)
SPC-1088D-P594 0.1ml
EUR 407
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to PE/ATTO 594.
Antibody for Human TBK1 (pSer172)
SPC-1088D-PCP 0.1ml
EUR 399
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to PerCP.
Antibody for Human TBK1 (pSer172)
SPC-1088D-RPE 0.1ml
EUR 397
Description: A polyclonal antibody for TBK1 (pSer172) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser172 of human TBK1 (AA169-175). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TBK1 (pSer172) antibody is conjugated to RPE .

Human TBK1(TANK Binding Kinase 1) ELISA Kit