Human SNAI1(Snail Homolog 1) ELISA Kit

To Order: Contact us

Human Snail Homolog 1 (SNAI1) ELISA Kit
RD-SNAI1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Snail Homolog 1 (SNAI1) ELISA Kit
RD-SNAI1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Snail Homolog 1 (SNAI1) ELISA Kit
RDR-SNAI1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Snail Homolog 1 (SNAI1) ELISA Kit
RDR-SNAI1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Snail Homolog 1 (SNAI1) ELISA Kit
20-abx153126	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Snail Homolog 1 (SNAI1) ELISA Kit
SEK089Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Snail Homolog 1 (SNAI1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Snail Homolog 1 (SNAI1) in tissue homogenates, cell lysates and other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit
SEK089Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Snail Homolog 1 (SNAI1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Snail Homolog 1 (SNAI1) in tissue homogenates, cell lysates and other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit
SEK089Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Snail Homolog 1 (SNAI1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Snail Homolog 1 (SNAI1) in tissue homogenates, cell lysates and other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit
SEK089Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Snail Homolog 1 (SNAI1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Snail Homolog 1 (SNAI1) in tissue homogenates, cell lysates and other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit
4-SEK089Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Snail Homolog 1 elisa. Alternative names of the recognized antigen: SLUGH2 SNA SNAH Snail 1 Zinc Finger Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Snail Homolog 1 (SNAI1) Antibody
20-abx213089	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Antibody
20-abx115629	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Antibody
20-abx131592	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Snail Homolog 1 (SNAI1) Antibody
20-abx174578	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Snail Homolog 1 (SNAI1) Antibody
abx331451-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Antibody
abx331682-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Antibody
20-abx326344	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Antibody
abx430958-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Recombinant Snail Homolog 1 (SNAI1)
4-RPK089Hu01	Cloud-Clone	EUR 410.02 EUR 212.00 EUR 1262.56 EUR 487.52 EUR 875.04 EUR 337.00 EUR 3006.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O95863 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Snail Homolog 1 expressed in: E.coli

Human Snail Homolog 1 (SNAI1) Protein
20-abx650781	Abbexa	EUR 578.00 EUR 258.00 EUR 1706.00 EUR 676.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Snail Homolog 1 (SNAI1) CLIA Kit
20-abx495818	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human SNAI1 (Snail Homolog 1)
ELK4384	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Snail Homolog 1 (SNAI1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Snail Homo Show more
Description: A sandwich ELISA kit for detection of Snail Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-Snail homolog 1 / SNAI1 antibody
STJ70994	St John's Laboratory	100 µg	EUR 359

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human)
4-PAK089Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SNAI1 (Met1~Arg264) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1)

Anti-Snail homolog 1 / SNAI1, Biotinylated antibody
STJ73236	St John's Laboratory	100 µg	EUR 359

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), APC
4-PAK089Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SNAI1 (Met1~Arg264) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with APC.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), Biotinylated
4-PAK089Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SNAI1 (Met1~Arg264) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with Biotin.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), Cy3
4-PAK089Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SNAI1 (Met1~Arg264) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with Cy3.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), FITC
4-PAK089Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SNAI1 (Met1~Arg264) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with FITC.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), HRP
4-PAK089Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SNAI1 (Met1~Arg264) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with HRP.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), PE
4-PAK089Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SNAI1 (Met1~Arg264) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with PE.

SNAIL (SNAI1) Antibody
20-abx004244	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

SNAIL (SNAI1) Antibody
abx031509-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SNAIL (SNAI1) Antibody
abx031509-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SNAIL (SNAI1) Antibody
abx031510-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SNAIL (SNAI1) Antibody
abx031510-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Polyclonal Snail homolog 1 / SNAI1 Antibody (N-Term)
APG00471G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Snail homolog 1 / SNAI1 (N-Term). This antibody is tested and proven to work in the following applications:

Snail Homolog 1 Phospho-Ser246 (SNAI1 pS246) Antibody
20-abx326345	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Snail Homolog 1 (SNAI1) Polyclonal Antibody (Human), APC-Cy7
4-PAK089Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SNAI1 (Met1~Arg264) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Snail Homolog 1 (SNAI1). This antibody is labeled with APC-Cy7.

Anti-SNAIL/SNAI1 Antibody
PB9399	BosterBio	100ug/vial	EUR 294

Polyclonal SNAI1 / SNAIL-1 Antibody (Internal)
APR03360G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SNAI1 / SNAIL-1 (Internal). This antibody is tested and proven to work in the following applications:

Human Snail Homolog ELISA kit
E01S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Snail Homolog ELISA kit
E01S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Snail Homolog ELISA kit
E01S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
20-abx008698	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
20-abx006763	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
20-abx126606	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
20-abx126607	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
abx122421-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
abx012238-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
abx012239-100ug	Abbexa	100 ug	EUR 425
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
20-abx012844	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
abx031511-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
abx031511-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
abx031512-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
abx031512-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
abx238051-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody
20-abx301285	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rabbit Snail Homolog ELISA kit
E04S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Snail Homolog ELISA kit
E04S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Snail Homolog ELISA kit
E04S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Snail Homolog ELISA kit
E02S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Snail Homolog ELISA kit
E02S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Snail Homolog ELISA kit
E02S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Snail Homolog ELISA kit
E03S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Snail Homolog ELISA kit
E03S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Snail Homolog ELISA kit
E03S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Snail Homolog ELISA kit
E06S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Snail Homolog ELISA kit
E06S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Snail Homolog ELISA kit
E06S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Snail Homolog ELISA kit
E08S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Snail Homolog ELISA kit
E08S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Snail Homolog ELISA kit
E08S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Snail Homolog ELISA kit
E07S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Snail Homolog ELISA kit
E07S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Snail Homolog ELISA kit
E07S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Snail Homolog ELISA kit
E09S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Snail Homolog ELISA kit
E09S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Snail Homolog ELISA kit
E09S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

SNAI1 Snail Family Zinc Finger 1 Human Recombinant Protein
PROTO95863	BosterBio	Regular: 20ug	EUR 317
Description: SNAI1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 287 amino acids (1-264 a.a) and having a molecular mass of 31.5kDa.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody (Biotin)
abx430959-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody (HRP)
20-abx305374	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody (FITC)
20-abx305375	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Snail Family Transcriptional Repressor 1 (SNAI1) Antibody (Biotin)
20-abx305376	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

human snail homolog 2,SNAI2 ELISA Kit
201-12-1878	SunredBio	96 tests	EUR 440
This snail homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human snail homolog 2, SNAI2 ELISA Kit
CSB-E11753h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human snail homolog 2, SNAI2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human snail homolog 2, SNAI2 ELISA Kit
1-CSB-E11753h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human snail homolog 2, SNAI2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human snail homolog 2(SNAI2)ELISA Kit
GA-E1894HM-48T	GenAsia Biotech	48T	EUR 289

Human snail homolog 2(SNAI2)ELISA Kit
GA-E1894HM-96T	GenAsia Biotech	96T	EUR 466

Human snail homolog 2(SNAI2)ELISA Kit
QY-E01031	Qayee Biotechnology	96T	EUR 361

Guinea pig Snail Homolog ELISA kit
E05S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Snail Homolog ELISA kit
E05S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Snail Homolog ELISA kit
E05S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Snail Homolog 2 (Drosophila) Antibody
20-abx115630	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

SNAI1 ELISA KIT|Human
EF003084	Lifescience Market	96 Tests	EUR 689

Human Zinc finger protein SNAI1, SNAI1 ELISA KIT
ELI-18182h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human Zinc finger protein SNAI1 (SNAI1)
KTE62329-48T	Abbkine	48T	EUR 332
SNAI1 is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.A single transc Show more
Description: Quantitative sandwich ELISA for measuring Human Zinc finger protein SNAI1 (SNAI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zinc finger protein SNAI1 (SNAI1)
KTE62329-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SNAI1 is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.A single transc Show more
Description: Quantitative sandwich ELISA for measuring Human Zinc finger protein SNAI1 (SNAI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zinc finger protein SNAI1 (SNAI1)
KTE62329-96T	Abbkine	96T	EUR 539
SNAI1 is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.A single transc Show more
Description: Quantitative sandwich ELISA for measuring Human Zinc finger protein SNAI1 (SNAI1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SNAI1 ELISA Kit (Human) (OKCD00589)
OKCD00589	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Involved in induction of the epithelial to mesenchymal transition (EMT), formation and maintenance of embryonic mesoderm, growth arrest, survival and cell migration. Binds to 3 E-boxes of the E-cadherin/CDH1 gene promoter and to the promoters of CLDN7 and KRT8 and, in association with histone demethylase KDM1A which it recruits to the promoters, causes a decrease in dimethylated H3K4 levels and represses transcription. Associates with EGR1 and SP1 to mediate tetradecanoyl phorbol acetate (TPA)-induced up-regulation of CDKN2B, possibly by binding to the CDKN2B promoter region 5'-TCACA-3. In addition, may also activate the CDKN2B promoter by itself.6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.7"The transcription factor Snail is a repressor of E-cadherin gene expression in epithelial tumour cells."_x005F_x005F_x000D_Batlle E., Sancho E., Franci C., Dominguez D., Monfar M., Baulida J., Garcia de Herreros A._x005F_x005F_x000D_Nat. Cell Biol. 2:84-89(2000) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] OF 1-172, FUNCTION, TISSUE SPECIFICITY.Ref.10"A molecular role for lysyl oxidase-like 2 enzyme in snail regulation and tumor progression."_x005F_x005F_x000D_Peinado H., Del Carmen Iglesias-de la Cruz M., Olmeda D., Csiszar K., Fong K.S., Vega S., Nieto M.A., Cano A., Portillo F._x005F_x005F_x000D_EMBO J. 24:3446-3458(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH LOXL2 AND LOXL3, MUTAGENESIS OF LYS-9; LYS-16; LYS-98 AND LYS-137.Ref.12"Wnt-dependent regulation of the E-cadherin repressor snail."_x005F_x005F_x000D_Yook J.I., Li X.Y., Ota I., Fearon E.R., Weiss S.J._x005F_x005F_x000D_J. Biol. Chem. 280:11740-11748(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH GSK3B AND BTRC, PHOSPHORYLATION AT SER-104 AND SER-107, MUTAGENESIS OF SER-96; SER-104 AND SER-107.Ref.16"Snail associates with EGR-1 and SP-1 to upregulate transcriptional activation of p15INK4b."_x005F_x005F_x000D_Hu C.T., Chang T.Y., Cheng C.C., Liu C.S., Wu J.R., Li M.C., Wu W.S._x005F_x005F_x000D_FEBS J. 277:1202-1218(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH EGR1, INDUCTION.Ref.21"Requirement of the histone demethylase LSD1 in Snai1-mediated transcriptional repression during epithelial-mesenchymal transition."_x005F_x005F_x000D_Lin T., Ponn A., Hu X., Law B.K., Lu J._x005F_x005F_x000D_Oncogene 29:4896-4904(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH KDM1A, MUTAGENESIS OF PRO-2.Ref.26"Lats2 kinase potentiates Snail1 activity by promoting nuclear retention upon phosphorylation."_x005F_x005F_x000D_Zhang K., Rodriguez-Aznar E., Yabuta N., Owen R.J., Mingot J.M., Nojima H., Nieto M.A., Longmore G.D._x005F_x005F_x000D_EMBO J. 31:29-43(2012) [PubMed] [Europe PMC] [Abstract]Cited for: IDENTIFICATION BY MASS SPECTROMETRY, FUNCTION, SUBCELLULAR LOCATION, PHOSPHORYLATION AT THR-203 BY LATS2, MUTAGENESIS OF THR-203. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

Mouse Zinc finger protein SNAI1, Snai1 ELISA KIT
ELI-18183m	Lifescience Market	96 Tests	EUR 865

SNAI1 Cell ELISA Kit
abx595555-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Snail
GT15245	Neuromics	100 ug	EUR 526

SNAI1 (pS246) Cell ELISA Kit
abx596033-296tests	Abbexa	2 × 96 tests	EUR 707
Shipped within 1-2 weeks.

Snail antibody
38667-100ul	SAB	100ul	EUR 252

anti-SNAIL
YF-PA14701	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SNAIL

anti-SNAIL
YF-PA14702	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SNAIL

anti-SNAIL
YF-PA14703	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to SNAIL

anti-SNAIL
YF-PA14704	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to SNAIL

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

SNAI1 Colorimetric Cell-Based ELISA Kit
EKC1532	BosterBio	100ul	EUR 572

SNAI1 Antibody
29041-100ul	SAB	100ul	EUR 252

SNAI1 antibody
70R-20415	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SNAI1 antibody

SNAI1 Antibody
35921-100ul	SAB	100ul	EUR 252

SNAI1 antibody
10R-10243	Fitzgerald	50 ul	EUR 219
Description: Mouse monoclonal SNAI1 antibody

SNAI1 antibody
10R-10704	Fitzgerald	100 ug	EUR 349
Description: Mouse monoclonal SNAI1 antibody

SNAI1 antibody
10R-5840	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SNAI1 antibody

SNAI1 antibody
10R-5841	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal SNAI1 antibody

SNAI1 Antibody
1-CSB-PA004123	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

SNAI1 Antibody
1-CSB-PA991705	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

SNAI1 Antibody
CSB-PA162021-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SNAI1 Antibody
CSB-PA162021-100ul	Cusabio	100ul	EUR 314
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SNAI1 antibody
70R-36806	Fitzgerald	100 ug	EUR 327
Description: Rabbit Polyclonal SNAI1 antibody

SNAI1 antibody
70R-50405	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal SNAI1 antibody

SNAI1 antibody
70R-7981	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SNAI1 antibody

SNAI1 Antibody
AF6032	Affbiotech	200ul	EUR 304
Description: SNAI1 Antibody detects endogenous levels of total SNAI1.

SNAI1 Antibody
BF0595	Affbiotech	200ul	EUR 376
Description: SNAI1 antibody detects endogenous levels of total SNAI1.

SNAI1 Antibody
1-CSB-PA021867GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SNAI1 Antibody
1-CSB-PA021867LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SNAI1. Recognizes SNAI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SNAI1 siRNA
20-abx934481	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SNAI1 siRNA
20-abx934482	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SNAI1 Antibody
ABF6032	Lifescience Market	100 ug	EUR 438

Human SNAI1 shRNA Plasmid
20-abx954498	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SNAI1 Recombinant Protein (Human)
RP029464	ABM	100 ug	Ask for price

Snail Rabbit pAb
A11794-100ul	Abclonal	100 ul	EUR 308

Snail Rabbit pAb
A11794-200ul	Abclonal	200 ul	EUR 459

Snail Rabbit pAb
A11794-20ul	Abclonal	20 ul	EUR 183

Snail Rabbit pAb
A11794-50ul	Abclonal	50 ul	EUR 223

Snail Rabbit pAb
A12301-100ul	Abclonal	100 ul	EUR 308

Snail Rabbit pAb
A12301-200ul	Abclonal	200 ul	EUR 459

Snail Rabbit pAb
A12301-20ul	Abclonal	20 ul	EUR 183

Snail Rabbit pAb
A12301-50ul	Abclonal	50 ul	EUR 223

Snail Conjugated Antibody
C38667	SAB	100ul	EUR 397

Snail Rabbit pAb
A5243-100ul	Abclonal	100 ul	EUR 308

Snail Rabbit pAb
A5243-200ul	Abclonal	200 ul	EUR 459

Snail Rabbit pAb
A5243-20ul	Abclonal	20 ul	EUR 183

Snail Rabbit pAb
A5243-50ul	Abclonal	50 ul	EUR 223

Snail Rabbit pAb
A5544-100ul	Abclonal	100 ul	EUR 308

Snail Rabbit pAb
A5544-200ul	Abclonal	200 ul	EUR 459

Snail Rabbit pAb
A5544-20ul	Abclonal	20 ul	EUR 183

Snail Rabbit pAb
A5544-50ul	Abclonal	50 ul	EUR 223

Anti-SNAIL (2G11)
YF-MA15499	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SNAIL

Anti-SNAIL (1A5)
YF-MA15500	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SNAIL

Human Snail Family Transcriptional Repressor 3 (SNAI3) ELISA Kit
abx383331-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

SNAI1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2205202	ABM	1.0 ug DNA	EUR 154

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human Notch Homolog 1 ELISA kit
E01N0594-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Snail Family Zinc Finger 1 Antibody
20-abx137480	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Snail Family Zinc Finger 1 Protein
20-abx261200	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

SNAI1 Colorimetric Cell-Based ELISA Kit (OKAG01044)
OKAG01044	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity:

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

SNAI1 Blocking Peptide
33R-6304	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SNAI1 antibody, catalog no. 70R-7981

SNAI1 antibody (Ser246)
70R-36329	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal SNAI1 antibody (Ser246)

SNAI1 (pS246) Antibody
abx012240-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

SNAI1 Blocking Peptide
20-abx063280	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

SNAI1 Blocking Peptide
AF6032-BP	Affbiotech	1mg	EUR 195

SNAI1 Conjugated Antibody
C35921	SAB	100ul	EUR 397

SNAI1 Conjugated Antibody
C29041	SAB	100ul	EUR 397

SNAI1 Blocking Peptide
BF0595-BP	Affbiotech	1mg	EUR 195

SNAI1 (pS246) Antibody
abx332967-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

SNAI1 (pS246) Antibody
abx333357-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

SNAI1 cloning plasmid
CSB-CL021867HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 795 Sequence: atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagcgagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctgctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgct Show more
Description: A cloning plasmid for the SNAI1 gene.

SNAI1 Polyclonal Antibody
A61062	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

anti- SNAI1 antibody
FNab08051	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IHC: 1:50-1:500 Immunogen: snail homolog 1(Drosophila) Uniprot ID: O95863 Gene ID: 6615 Research Area: Metabolism, Cardiovascular, Developmental biology, Neuroscience, Stem Cells
Description: Antibody raised against SNAI1

anti-SNAI1 (6D2)
LF-MA30539	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to SNAI1

Anti-SNAI1 antibody
PAab08051	Lifescience Market	100 ug	EUR 386

Anti-SNAI1 antibody
STJ27533	St John's Laboratory	100 µl	EUR 277
Description: The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.

Anti-SNAI1 antibody
STJ113375	St John's Laboratory	100 µl	EUR 277
Description: The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.

Anti-SNAI1 antibody
STJ114189	St John's Laboratory	100 µl	EUR 277
Description: The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.

Anti-SNAI1 antibody
STJ29909	St John's Laboratory	100 µl	EUR 277
Description: The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

SNAI1 ORF Vector (Human) (pORF)
ORF009822	ABM	1.0 ug DNA	EUR 95

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

pEGFP-N1-Snail Plasmid
PVTB00223-2a	Lifescience Market	2 ug	EUR 356

SNAI1 (Phospho-Ser246) Colorimetric Cell-Based ELISA Kit
EKC2339	BosterBio	100ul	EUR 572

Human Frizzled Homolog 1 (FZD1)ELISA Kit
201-12-2369	SunredBio	96 tests	EUR 440
This Frizzled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit Homolog 1 (Slit1)ELISA Kit
201-12-2565	SunredBio	96 tests	EUR 440
This Slit Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Diaphanous Homolog 1 (DIAPH1)ELISA Kit
201-12-2655	SunredBio	96 tests	EUR 440
This Diaphanous Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Disabled Homolog 1 (DAB1)ELISA Kit
201-12-2657	SunredBio	96 tests	EUR 440
This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Atonal Homolog 1 (ATOH1)ELISA Kit
201-12-2838	SunredBio	96 tests	EUR 440
This Atonal Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Chromobox Homolog 1 (CBX1)ELISA Kit
201-12-2894	SunredBio	96 tests	EUR 440
This Chromobox Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Slingshot Homolog 1 (SSH1) ELISA Kit
DLR-SSH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.

Human Slingshot Homolog 1 (SSH1) ELISA Kit
DLR-SSH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.

Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
DLR-DIAPH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diaphanous Homolog 1 (DIAPH1) in samples from tissue homogenates or other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
DLR-DIAPH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diaphanous Homolog 1 (DIAPH1) in samples from tissue homogenates or other biological fluids.

Human Frizzled Homolog 1 (FZD1) ELISA Kit
DLR-FZD1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.

Human Frizzled Homolog 1 (FZD1) ELISA Kit
DLR-FZD1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.

Human Roundabout homolog 1(ROBO1) ELISA kit
CSB-EL020054HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1 (ROBO1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Roundabout homolog 1(ROBO1) ELISA kit
1-CSB-EL020054HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1(ROBO1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human DAB1/ Disabled homolog 1 ELISA Kit
E0654Hu	Sunlong	1 Kit	EUR 605

Human Achaete scute homolog 1 ELISA kit
E01A0079-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Achaete scute homolog 1 ELISA kit
E01A0079-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit
E01P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit
E01P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit
E01P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dickkopf 1 Homolog (DKK1) ELISA Kit
abx054998-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human SNAI1(Snail Homolog 1) ELISA Kit