Human PRCP(Prolylcarboxypeptidase) ELISA Kit

To Order: Contact us

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

RD-PRCP-Hu-48Tests 48 Tests
EUR 500

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

RD-PRCP-Hu-96Tests 96 Tests
EUR 692

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

RDR-PRCP-Hu-48Tests 48 Tests
EUR 522

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

RDR-PRCP-Hu-96Tests 96 Tests
EUR 724

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

EUR 528
  • Should the Rat Prolylcarboxypeptidase (PRCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolylcarboxypeptidase (PRCP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

EUR 690
  • Should the Rat Prolylcarboxypeptidase (PRCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Prolylcarboxypeptidase (PRCP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

RD-PRCP-Ra-48Tests 48 Tests
EUR 534

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

RD-PRCP-Ra-96Tests 96 Tests
EUR 742

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

RDR-PRCP-Ra-48Tests 48 Tests
EUR 558

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

RDR-PRCP-Ra-96Tests 96 Tests
EUR 776

Human PRCP(Prolylcarboxypeptidase) ELISA Kit

EH3647 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P42785
  • Alias: PRCP/Angiotensinase C/HUMPCP/Angiotensinase C/HUMPCP/Lysosomal carboxypeptidase C/lysosomal Pro-X carboxypeptidase/Proline carboxypeptidase/Prolylcarboxypeptidase/prolylcarboxypeptidase(angiot
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

abx253036-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

SEB253Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates, urine and other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

SEB253Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates, urine and other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

SEB253Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates, urine and other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

SEB253Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates, urine and other biological fluids.

Human Prolylcarboxypeptidase (PRCP) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prolylcarboxypeptidase elisa. Alternative names of the recognized antigen: PCP
  • Lysosomal Pro-X Carboxypeptidase
  • Angiotensinase C
  • Lysosomal carboxypeptidase C
  • Proline carboxypeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prolylcarboxypeptidase (PRCP) in samples from Serum, plasma, tissue homogenates, urine and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Prolylcarboxypeptidase(PRCP)ELISA Kit

QY-E03540 96T
EUR 361

Pig Prolylcarboxypeptidase (PRCP) ELISA Kit

abx360703-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Prolylcarboxypeptidase (PRCP) ELISA Kit

abx362822-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat PRCP(Prolylcarboxypeptidase) ELISA Kit

ER1287 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: PRCP/Angiotensinase C/HUMPCP/Angiotensinase C/EC carboxypeptidase C/lysosomal Pro-X carboxypeptidase/PCPMGC2202/Proline carboxypeptidase/Prolylcarboxypeptidase/prolylcarboxypeptidase(an
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Prolylcarboxypeptidase (PRCP) ELISA Kit

abx356312-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Prolylcarboxypeptidase (PRCP) ELISA Kit

abx358738-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

abx255952-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Prolylcarboxypeptidase (PRCP) ELISA Kit

abx390310-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

SEB253Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

SEB253Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

SEB253Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

SEB253Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prolylcarboxypeptidase (PRCP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prolylcarboxypeptidase (PRCP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Prolylcarboxypeptidase (PRCP) ELISA Kit

  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prolylcarboxypeptidase elisa. Alternative names of the recognized antigen: PCP
  • Lysosomal Pro-X Carboxypeptidase
  • Angiotensinase C
  • Lysosomal carboxypeptidase C
  • Proline carboxypeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Prolylcarboxypeptidase (PRCP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Prolylcarboxypeptidase(PRCP)ELISA Kit

QY-E10042 96T
EUR 361

Mouse Prolylcarboxypeptidase(PRCP)ELISA Kit

QY-E21241 96T
EUR 361

Prolylcarboxypeptidase (PRCP) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prolylcarboxypeptidase (PRCP) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prolylcarboxypeptidase (PRCP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prolylcarboxypeptidase (PRCP) Antibody

abx036095-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody

abx027380-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody

abx027380-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Prolylcarboxypeptidase (PRCP) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Prolylcarboxypeptidase (PRCP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody

abx236751-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Prolylcarboxypeptidase (PRCP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Prolylcarboxypeptidase (PRCP)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P42785
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.8kDa
  • Isoelectric Point: 6.4
Description: Recombinant Human Prolylcarboxypeptidase expressed in: E.coli

Recombinant Prolylcarboxypeptidase (PRCP)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q7TMR0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.5KDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Prolylcarboxypeptidase expressed in: E.coli

Recombinant Prolylcarboxypeptidase (PRCP)

  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4AA31
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.5kDa
  • Isoelectric Point: 8.5
Description: Recombinant Rat Prolylcarboxypeptidase expressed in: E.coli

ELISA kit for Human PRCP (Prolylcarboxypeptidase)

ELK4632 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prolylcarboxypeptidase (PRCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prol
  • Show more
Description: A sandwich ELISA kit for detection of Prolylcarboxypeptidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human PRCP (Prolylcarboxypeptidase)

E-EL-H1281 1 plate of 96 wells
EUR 534
  • Gentaur's PRCP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PRCP. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PRCP (Prolylcarboxypeptidase) in samples from Serum, Plasma, Cell supernatant

Human Prolylcarboxypeptidase (PRCP) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Prolylcarboxypeptidase (PRCP) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Rat PRCP (Prolylcarboxypeptidase)

ELK7279 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prolylcarboxypeptidase (PRCP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prol
  • Show more
Description: A sandwich ELISA kit for detection of Prolylcarboxypeptidase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat PRCP (Prolylcarboxypeptidase)

E-EL-R0784 1 plate of 96 wells
EUR 534
  • Gentaur's PRCP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PRCP. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PRCP (Prolylcarboxypeptidase) in samples from Serum, Plasma, Cell supernatant

PRCP ELISA Kit| Rat Prolylcarboxypeptidase ELISA Kit

EF017999 96 Tests
EUR 689

Rat Prolylcarboxypeptidase (PRCP) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Prolylcarboxypeptidase (PRCP) CLIA Kit

abx197560-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Prolylcarboxypeptidase (PRCP) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Prolylcarboxypeptidase (PRCP) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prolylcarboxypeptidase (PRCP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Asp108~Val376)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP)

CLIA kit for Rat PRCP (Prolylcarboxypeptidase)

E-CL-R0557 1 plate of 96 wells
EUR 584
  • Gentaur's PRCP CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat PRCP . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat PRCP (Prolylcarboxypeptidase) in samples from Serum, Plasma, Cell supernatant

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Gln169~Leu443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP)

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Met113~Ser350)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP)

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Asp108~Val376)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Asp108~Val376)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with Biotin.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Asp108~Val376)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with Cy3.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Asp108~Val376)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with FITC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Asp108~Val376)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with HRP.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Asp108~Val376)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with PE.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Asp108~Val376)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC-Cy7.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Gln169~Leu443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Gln169~Leu443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with Biotin.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Gln169~Leu443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with Cy3.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Gln169~Leu443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with FITC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Gln169~Leu443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with HRP.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Gln169~Leu443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with PE.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), APC

  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Met113~Ser350)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), Biotinylated

  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Met113~Ser350)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with Biotin.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), Cy3

  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Met113~Ser350)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with Cy3.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), FITC

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Met113~Ser350)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with FITC.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), HRP

  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Met113~Ser350)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with HRP.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), PE

  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Met113~Ser350)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with PE.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Gln169~Leu443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC-Cy7.

Prolylcarboxypeptidase (PRCP) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRCP (Met113~Ser350)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Prolylcarboxypeptidase (PRCP). This antibody is labeled with APC-Cy7.

Human Prolylcarboxypeptidase ELISA kit

E01P0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prolylcarboxypeptidase ELISA kit

E01P0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prolylcarboxypeptidase ELISA kit

E01P0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


EHP0144 96Tests
EUR 521


EF007108 96 Tests
EUR 689

Rat Prolylcarboxypeptidase ELISA kit

E02P0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prolylcarboxypeptidase ELISA kit

E02P0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prolylcarboxypeptidase ELISA kit

E02P0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prolylcarboxypeptidase ELISA kit

E03P0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prolylcarboxypeptidase ELISA kit

E03P0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prolylcarboxypeptidase ELISA kit

E03P0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prolylcarboxypeptidase ELISA kit

E04P0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prolylcarboxypeptidase ELISA kit

E04P0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prolylcarboxypeptidase ELISA kit

E04P0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Prolylcarboxypeptidase ELISA kit

E06P0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Prolylcarboxypeptidase ELISA kit

E06P0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Prolylcarboxypeptidase ELISA kit

E06P0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Prolylcarboxypeptidase ELISA kit

E07P0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Prolylcarboxypeptidase ELISA kit

E07P0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Prolylcarboxypeptidase ELISA kit

E07P0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Prolylcarboxypeptidase ELISA kit

E08P0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Prolylcarboxypeptidase ELISA kit

E08P0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Prolylcarboxypeptidase ELISA kit

E08P0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Prolylcarboxypeptidase ELISA kit

E09P0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Prolylcarboxypeptidase ELISA kit

E09P0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Prolylcarboxypeptidase ELISA kit

E09P0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PRCP ELISA Kit (Human) (OKCD07253)

OKCD07253 96 Wells
EUR 936
Description: Description of target: 1-(1-phencyclohexyl) piperidine, known as Phencyclidine, was developed in 1926 as a surgical anesthetic. Its development in human was discontinued in 1965 due to its severe adverse effects. At low to moderate doses, PCP increases breathing rate, blood pressure and pulse rate. Generalized numbness of the extremities and loss of muscular coordination also may occur. Psychological effects include distinct changes in body awareness. High dose PCP decreases blood pressure, pulse rate, and respiration. This may be accompanied by nausea, vomiting, blurred vision, flicking up and down of the eyes, drooling, loss of balance, and dizziness. Psychological effects at high doses include illusions and hallucinations. High doses of PCP can also cause seizures, coma, and death. High doses can cause symptoms that mimic schizophrenia, such as delusions, hallucinations, paranoia, disordered thinking, a sensation of distance from one's environment, and catatonia. Speech is often sparse and garbled. People who use PCP for long periods report memory loss, difficulties with speech and thinking, depression, and weight loss. These symptoms can persist up to a year after stopping PCP use. Mood disorders also have been reported. PCP has sedative effects, and interactions with other central nervous system depressants, such as alcohol and benzodiazepines, can lead to coma.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 30pg/mL

PRCP ELISA Kit (Human) (OKDD00481)

OKDD00481 96 Wells
EUR 923
Description: Description of target: This gene encodes a member of the peptidase S28 family of serine exopeptidases. The encoded preproprotein is proteolytically processed to generate the mature lysosomal prolylcarboxypeptidase. This enzyme cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. A pseudogene of this gene has been identified on chromosome 2. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.054 ng/mL


EGTP0144 96Tests
EUR 521


EBP0144 96Tests
EUR 521

Chicken PRCP ELISA Kit

ECKP0144 96Tests
EUR 521

Anserini PRCP ELISA Kit

EAP0144 96Tests
EUR 521


ECP0144 96Tests
EUR 521

Porcine PRCP ELISA Kit

EPP0144 96Tests
EUR 521


ERP0144 96Tests
EUR 521


ERTP0144 96Tests
EUR 521


ESP0144 96Tests
EUR 521


EMKP0144 96Tests
EUR 521


EMP0144 96Tests
EUR 521

Guinea pig Prolylcarboxypeptidase ELISA kit

E05P0137-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Prolylcarboxypeptidase ELISA kit

E05P0137-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Prolylcarboxypeptidase ELISA kit

E05P0137-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Prolylcarboxypeptidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig PRCP ELISA Kit

EGP0144 96Tests
EUR 521

PRCP ELISA Kit (Rat) (OKCD07254)

OKCD07254 96 Wells
EUR 1001
Description: Description of target: This gene encodes a member of the peptidase S28 family of serine exopeptidases. The encoded preproprotein is proteolytically processed to generate the mature lysosomal prolylcarboxypeptidase. This enzyme cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. A pseudogene of this gene has been identified on chromosome 2. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.28ng/mL

PRCP ELISA Kit (Rat) (OKDD00482)

OKDD00482 96 Wells
EUR 1001
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.042 ng/mL

PRCP ELISA Kit (Mouse) (OKCA00905)

OKCA00905 96 Wells
EUR 833
Description: Description of target: Cleaves C-terminal amino acids linked to proline in peptides such as angiotensin II, III and des-Arg9-bradykinin. This cleavage occurs at acidic pH, but enzymatic activity is retained with some substrates at neutral pH.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.37 pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRCP Antibody

31116-100ul 100ul
EUR 252

PRCP Antibody

31116-50ul 50ul
EUR 187

PRCP antibody

70R-19500 50 ul
EUR 435
Description: Rabbit polyclonal PRCP antibody

PRCP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PRCP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PRCP Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PRCP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200


YF-PA13964 50 ug
EUR 363
Description: Mouse polyclonal to PRCP


YF-PA13965 100 ug
EUR 403
Description: Rabbit polyclonal to PRCP

Human Lysosomal Pro- X carboxypeptidase, PRCP ELISA KIT

ELI-14612h 96 Tests
EUR 824

Human PRCP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRCP Recombinant Protein (Human)

RP024505 100 ug Ask for price

ELISA kit for Human Lysosomal Pro-X carboxypeptidase (PRCP)

KTE61186-48T 48T
EUR 332
  • Lysosomal Pro-X carboxypeptidase is a lysosomal prolylcarboxypeptidase, which cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lysosomal Pro-X carboxypeptidase (PRCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Lysosomal Pro-X carboxypeptidase (PRCP)

KTE61186-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Lysosomal Pro-X carboxypeptidase is a lysosomal prolylcarboxypeptidase, which cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lysosomal Pro-X carboxypeptidase (PRCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Lysosomal Pro-X carboxypeptidase (PRCP)

KTE61186-96T 96T
EUR 539
  • Lysosomal Pro-X carboxypeptidase is a lysosomal prolylcarboxypeptidase, which cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lysosomal Pro-X carboxypeptidase (PRCP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PRCP Conjugated Antibody

C31116 100ul
EUR 397

PRCP cloning plasmid

CSB-CL018636HU-10ug 10ug
EUR 527
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1491
  • Sequence: atgggccgccgagccctcctgctcctgcttctgtcttttctggcgccctgggccaccatagccctccggccggccttaagggccctcggcagcctacacttgccaaccaaccccacatccctcccggctgtagccaagaactattcggttctctacttccaacagaaggttgatc
  • Show more
Description: A cloning plasmid for the PRCP gene.

anti- PRCP antibody

FNab06751 100µg
EUR 505.25
  • Immunogen: prolylcarboxypeptidase(angiotensinase C)
  • Uniprot ID: P42785
  • Gene ID: 5547
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against PRCP

PRCP Rabbit pAb

A4040-100ul 100 ul
EUR 308

PRCP Rabbit pAb

A4040-200ul 200 ul
EUR 459

PRCP Rabbit pAb

A4040-20ul 20 ul
EUR 183

PRCP Rabbit pAb

A4040-50ul 50 ul
EUR 223

PRCP Polyclonal Antibody

A68663 100 ?g
EUR 628.55
Description: Ask the seller for details

Anti-PRCP antibody

PAab06751 100 ug
EUR 355

Anti-PRCP antibody

STJ25100 100 µl
EUR 277
Description: This gene encodes a member of the peptidase S28 family of serine exopeptidases. The encoded preproprotein is proteolytically processed to generate the mature lysosomal prolylcarboxypeptidase. This enzyme cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. A pseudogene of this gene has been identified on chromosome 2. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.

Anti-PRCP Antibody

STJ193169 200 µl
EUR 197

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

PRCP ORF Vector (Human) (pORF)

ORF008169 1.0 ug DNA
EUR 95

Prolylcarboxypeptidase (Angiotensinase C) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse Lysosomal Pro- X carboxypeptidase, Prcp ELISA KIT

ELI-21530m 96 Tests
EUR 865

Bovine Lysosomal Pro- X carboxypeptidase, PRCP ELISA KIT

ELI-45852b 96 Tests
EUR 928

Mouse Lysosomal Pro-X carboxypeptidase(PRCP) ELISA kit

CSB-EL018636MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lysosomal Pro-X carboxypeptidase (PRCP) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Lysosomal Pro-X carboxypeptidase(PRCP) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lysosomal Pro-X carboxypeptidase(PRCP) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse PRCP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRCP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRCP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRCP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRCP. Recognizes PRCP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PRCP Recombinant Protein (Rat)

RP221936 100 ug Ask for price

PRCP Recombinant Protein (Mouse)

RP164225 100 ug Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PRCP sgRNA CRISPR Lentivector set (Human)

K1715401 3 x 1.0 ug
EUR 339

Prcp ELISA Kit| Mouse Lysosomal Pro-X carboxypeptidase ELISA Ki

EF015950 96 Tests
EUR 689

PRCP ELISA Kit| Bovine Lysosomal Pro-X carboxypeptidase ELISA K

EF011794 96 Tests
EUR 689

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PRCP sgRNA CRISPR Lentivector (Human) (Target 1)

K1715402 1.0 ug DNA
EUR 154

PRCP sgRNA CRISPR Lentivector (Human) (Target 2)

K1715403 1.0 ug DNA
EUR 154

PRCP sgRNA CRISPR Lentivector (Human) (Target 3)

K1715404 1.0 ug DNA
EUR 154

PRCP Protein Vector (Human) (pPB-C-His)

PV032673 500 ng
EUR 329

PRCP Protein Vector (Human) (pPB-N-His)

PV032674 500 ng
EUR 329

PRCP Protein Vector (Human) (pPM-C-HA)

PV032675 500 ng
EUR 329

PRCP Protein Vector (Human) (pPM-C-His)

PV032676 500 ng
EUR 329

Polyclonal PRCP Antibody (N-term)

APR03813G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRCP (N-term). This antibody is tested and proven to work in the following applications:

PRCP Polyclonal Antibody, HRP Conjugated

A68664 100 ?g
EUR 628.55
Description: The best epigenetics products

PRCP Polyclonal Antibody, FITC Conjugated

A68665 100 ?g
EUR 628.55
Description: kits suitable for this type of research

PRCP Polyclonal Antibody, Biotin Conjugated

A68666 100 ?g
EUR 628.55
Description: fast delivery possible

Prcp ORF Vector (Rat) (pORF)

ORF073980 1.0 ug DNA
EUR 506

Prcp ORF Vector (Mouse) (pORF)

ORF054743 1.0 ug DNA
EUR 506

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Prcp sgRNA CRISPR Lentivector set (Mouse)

K3740501 3 x 1.0 ug
EUR 339

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Recombinant Human Lysosomal Pro-X Carboxypeptidase/PRCP (C-6His)

CA37-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM NaAc-HAc,150mM NaCl,10%Glycerol,pH4.5.

Recombinant Human Lysosomal Pro-X Carboxypeptidase/PRCP (C-6His)

CA37-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM NaAc-HAc,150mM NaCl,10%Glycerol,pH4.5.

Recombinant Human Lysosomal Pro-X Carboxypeptidase/PRCP (C-6His)

CA37-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM NaAc-HAc,150mM NaCl,10%Glycerol,pH4.5.

Recombinant Human Lysosomal Pro-X Carboxypeptidase/PRCP (C-6His)

CA37-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM NaAc-HAc,150mM NaCl,10%Glycerol,pH4.5.

Prcp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3740502 1.0 ug DNA
EUR 154

Prcp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3740503 1.0 ug DNA
EUR 154

Prcp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3740504 1.0 ug DNA
EUR 154

PRCP Protein Vector (Mouse) (pPB-C-His)

PV218970 500 ng
EUR 603

PRCP Protein Vector (Mouse) (pPB-N-His)

PV218971 500 ng
EUR 603

PRCP Protein Vector (Mouse) (pPM-C-HA)

PV218972 500 ng
EUR 603

PRCP Protein Vector (Mouse) (pPM-C-His)

PV218973 500 ng
EUR 603

PRCP Protein Vector (Rat) (pPB-C-His)

PV295918 500 ng
EUR 603

PRCP Protein Vector (Rat) (pPB-N-His)

PV295919 500 ng
EUR 603

PRCP Protein Vector (Rat) (pPM-C-HA)

PV295920 500 ng
EUR 603

PRCP Protein Vector (Rat) (pPM-C-His)

PV295921 500 ng
EUR 603

Human PRCP(Prolylcarboxypeptidase) ELISA Kit