Human PALMD(Palmdelphin) ELISA Kit

Human PALMD(Palmdelphin) ELISA Kit

To Order: Contact us

Human Palmdelphin (PALMD) ELISA Kit

RDR-PALMD-Hu-48Tests 48 Tests
EUR 544

Human Palmdelphin (PALMD) ELISA Kit

RDR-PALMD-Hu-96Tests 96 Tests
EUR 756

Human Palmdelphin (PALMD) ELISA Kit

RD-PALMD-Hu-48Tests 48 Tests
EUR 521

Human Palmdelphin (PALMD) ELISA Kit

RD-PALMD-Hu-96Tests 96 Tests
EUR 723

Human Palmdelphin(PALMD) ELISA kit

E01P0827-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Palmdelphin(PALMD) ELISA kit

E01P0827-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Palmdelphin(PALMD) ELISA kit

E01P0827-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Palmdelphin (PALMD) ELISA Kit

20-abx152631
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Palmdelphin, PALMD ELISA KIT

ELI-23306h 96 Tests
EUR 824

Human Palmdelphin(PALMD)ELISA Kit

QY-E04711 96T
EUR 361

Human Palmdelphin (PALMD) ELISA Kit

SEH463Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Palmdelphin (PALMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Palmdelphin (PALMD) in Tissue homogenates and other biological fluids.

Human Palmdelphin (PALMD) ELISA Kit

SEH463Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Palmdelphin (PALMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Palmdelphin (PALMD) in Tissue homogenates and other biological fluids.

Human Palmdelphin (PALMD) ELISA Kit

SEH463Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Palmdelphin (PALMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Palmdelphin (PALMD) in Tissue homogenates and other biological fluids.

Human Palmdelphin (PALMD) ELISA Kit

SEH463Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Palmdelphin (PALMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Palmdelphin (PALMD) in Tissue homogenates and other biological fluids.

Human Palmdelphin (PALMD) ELISA Kit

4-SEH463Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Palmdelphin elisa. Alternative names of the recognized antigen: PALML
  • C1orf11
  • Paralemmin Like Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Palmdelphin (PALMD) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rabbit Palmdelphin(PALMD) ELISA kit

E04P0827-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Palmdelphin(PALMD) ELISA kit

E04P0827-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Palmdelphin(PALMD) ELISA kit

E04P0827-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Palmdelphin(PALMD) ELISA kit

E02P0827-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Palmdelphin(PALMD) ELISA kit

E02P0827-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Palmdelphin(PALMD) ELISA kit

E02P0827-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Palmdelphin(PALMD) ELISA kit

E03P0827-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Palmdelphin(PALMD) ELISA kit

E03P0827-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Palmdelphin(PALMD) ELISA kit

E03P0827-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Palmdelphin(PALMD) ELISA kit

E06P0827-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Palmdelphin(PALMD) ELISA kit

E06P0827-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Palmdelphin(PALMD) ELISA kit

E06P0827-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Palmdelphin(PALMD) ELISA kit

E08P0827-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Palmdelphin(PALMD) ELISA kit

E08P0827-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Palmdelphin(PALMD) ELISA kit

E08P0827-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Palmdelphin(PALMD) ELISA kit

E07P0827-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Palmdelphin(PALMD) ELISA kit

E07P0827-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Palmdelphin(PALMD) ELISA kit

E07P0827-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Palmdelphin(PALMD) ELISA kit

E09P0827-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Palmdelphin(PALMD) ELISA kit

E09P0827-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Palmdelphin(PALMD) ELISA kit

E09P0827-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Palmdelphin, PALMD ELISA KIT

ELI-14685p 96 Tests
EUR 928

Mouse Palmdelphin, Palmd ELISA KIT

ELI-16194m 96 Tests
EUR 865

Bovine Palmdelphin, PALMD ELISA KIT

ELI-23305b 96 Tests
EUR 928

Rat Palmdelphin, Palmd ELISA KIT

ELI-37780r 96 Tests
EUR 886

Palmdelphin (PALMD) Antibody

abx027275-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Palmdelphin (PALMD) Antibody

abx027275-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Palmdelphin (PALMD) Antibody

20-abx003635
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Palmdelphin (PALMD) Antibody

20-abx177909
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Palmdelphin (PALMD) Antibody

20-abx173942
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Palmdelphin (PALMD) Antibody

abx236128-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ELISA kit for Human PALMD (Palmdelphin)

ELK4570 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Palmdelphin (PALMD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Palmdelphin (P
  • Show more
Description: A sandwich ELISA kit for detection of Palmdelphin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Palmdelphin (PALMD)

KTE61311-48T 48T
EUR 332
  • It has an N-terminal coiled-coil region that shares 45% amino acid identity with an N-terminal region in AKAP2 . Overall, PALML shares 36% amino acid identity with paralemmin (PALM). The shorter PALML variant encodes a deduced 471-amino acid protein
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Palmdelphin (PALMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Palmdelphin (PALMD)

KTE61311-5platesof96wells 5 plates of 96 wells
EUR 2115
  • It has an N-terminal coiled-coil region that shares 45% amino acid identity with an N-terminal region in AKAP2 . Overall, PALML shares 36% amino acid identity with paralemmin (PALM). The shorter PALML variant encodes a deduced 471-amino acid protein
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Palmdelphin (PALMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Palmdelphin (PALMD)

KTE61311-96T 96T
EUR 539
  • It has an N-terminal coiled-coil region that shares 45% amino acid identity with an N-terminal region in AKAP2 . Overall, PALML shares 36% amino acid identity with paralemmin (PALM). The shorter PALML variant encodes a deduced 471-amino acid protein
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Palmdelphin (PALMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Palmdelphin (PALMD) CLIA Kit

20-abx495454
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Palmdelphin (PALMD) Protein

20-abx654649
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Guinea pig Palmdelphin(PALMD) ELISA kit

E05P0827-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Palmdelphin(PALMD) ELISA kit

E05P0827-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Palmdelphin(PALMD) ELISA kit

E05P0827-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Palmdelphin(PALMD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PALMD ELISA KIT|Human

EF001539 96 Tests
EUR 689

PALMD ELISA Kit (Human) (OKCD01955)

OKCD01955 96 Wells
EUR 831
Description: Description of target: This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.61 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

PALMD antibody

70R-19103 50 ul
EUR 435
Description: Rabbit polyclonal PALMD antibody

PALMD Antibody

DF12685 200ul
EUR 304
Description: PALMD Antibody detects endogenous levels of PALMD.

PALMD Antibody

1-CSB-PA017416GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PALMD. Recognizes PALMD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PALMD siRNA

20-abx903831
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PALMD siRNA

20-abx927663
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PALMD siRNA

20-abx927664
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Palmdelphin Polyclonal Antibody

20-abx116886
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human PALMD shRNA Plasmid

20-abx960283
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PALMD Recombinant Protein (Human)

RP022498 100 ug Ask for price

PALMD Blocking Peptide

DF12685-BP 1mg
EUR 195

Polyclonal PALMD Antibody

APR06920G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PALMD . This antibody is tested and proven to work in the following applications:

PALMD cloning plasmid

CSB-CL017416HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1656
  • Sequence: atggaagaagctgagctggtgaagggaagactccaggccatcacagataaaagaaaaatacaggaagaaatctcacagaagcgtctgaaaatagaggaagacaaactaaagcaccagcatttgaagaaaaaggccttgagggagaaatggcttctagatggaatcagcagcggaa
  • Show more
Description: A cloning plasmid for the PALMD gene.

PALMD Rabbit pAb

A4801-100ul 100 ul
EUR 308

PALMD Rabbit pAb

A4801-200ul 200 ul
EUR 459

PALMD Rabbit pAb

A4801-20ul 20 ul Ask for price

PALMD Rabbit pAb

A4801-50ul 50 ul Ask for price

anti- PALMD antibody

FNab06128 100µg
EUR 505.25
  • Immunogen: palmdelphin
  • Uniprot ID: Q9NP74
  • Gene ID: 54873
  • Research Area: Signal Transduction
Description: Antibody raised against PALMD

Anti-PALMD antibody

PAab06128 100 ug
EUR 355

Anti-PALMD antibody

STJ26873 100 µl
EUR 277

PALMD ORF Vector (Human) (pORF)

ORF007500 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat PALMD shRNA Plasmid

20-abx989635
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PALMD shRNA Plasmid

20-abx980155
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PALMD Recombinant Protein (Mouse)

RP160001 100 ug Ask for price

PALMD Recombinant Protein (Rat)

RP219218 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

PALMD sgRNA CRISPR Lentivector set (Human)

K1590901 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Polyclonal PALMD Antibody (N-term)

APR03788G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PALMD (N-term). This antibody is tested and proven to work in the following applications:

Palmd ORF Vector (Rat) (pORF)

ORF073074 1.0 ug DNA
EUR 506

Palmd ORF Vector (Mouse) (pORF)

ORF053335 1.0 ug DNA
EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PALMD sgRNA CRISPR Lentivector (Human) (Target 1)

K1590902 1.0 ug DNA
EUR 154

PALMD sgRNA CRISPR Lentivector (Human) (Target 2)

K1590903 1.0 ug DNA
EUR 154

PALMD sgRNA CRISPR Lentivector (Human) (Target 3)

K1590904 1.0 ug DNA
EUR 154

PALMD Protein Vector (Human) (pPB-C-His)

PV029997 500 ng
EUR 329

PALMD Protein Vector (Human) (pPB-N-His)

PV029998 500 ng
EUR 329

PALMD Protein Vector (Human) (pPM-C-HA)

PV029999 500 ng
EUR 329

PALMD Protein Vector (Human) (pPM-C-His)

PV030000 500 ng
EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Polyclonal PALMD Antibody - N-terminal region

APR01632G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PALMD - N-terminal region. This antibody is tested and proven to work in the following applications:

Palmd sgRNA CRISPR Lentivector set (Rat)

K7478201 3 x 1.0 ug
EUR 339

Palmd sgRNA CRISPR Lentivector set (Mouse)

K3768801 3 x 1.0 ug
EUR 339

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

Palmd sgRNA CRISPR Lentivector (Rat) (Target 1)

K7478202 1.0 ug DNA
EUR 154

Palmd sgRNA CRISPR Lentivector (Rat) (Target 2)

K7478203 1.0 ug DNA
EUR 154

Palmd sgRNA CRISPR Lentivector (Rat) (Target 3)

K7478204 1.0 ug DNA
EUR 154

Palmd sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3768802 1.0 ug DNA
EUR 154

Palmd sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3768803 1.0 ug DNA
EUR 154

Palmd sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3768804 1.0 ug DNA
EUR 154

PALMD Protein Vector (Rat) (pPB-C-His)

PV292294 500 ng
EUR 603

PALMD Protein Vector (Rat) (pPB-N-His)

PV292295 500 ng
EUR 603

PALMD Protein Vector (Rat) (pPM-C-HA)

PV292296 500 ng
EUR 603

PALMD Protein Vector (Rat) (pPM-C-His)

PV292297 500 ng
EUR 603

PALMD Protein Vector (Mouse) (pPB-C-His)

PV213338 500 ng
EUR 603

PALMD Protein Vector (Mouse) (pPB-N-His)

PV213339 500 ng
EUR 603

PALMD Protein Vector (Mouse) (pPM-C-HA)

PV213340 500 ng
EUR 603

PALMD Protein Vector (Mouse) (pPM-C-His)

PV213341 500 ng
EUR 603

Palmd 3'UTR Luciferase Stable Cell Line

TU115872 1.0 ml Ask for price

Palmd 3'UTR GFP Stable Cell Line

TU165872 1.0 ml Ask for price

Palmd 3'UTR Luciferase Stable Cell Line

TU215782 1.0 ml Ask for price

Palmd 3'UTR GFP Stable Cell Line

TU265782 1.0 ml Ask for price

PALMD 3'UTR GFP Stable Cell Line

TU067357 1.0 ml
EUR 1394

PALMD 3'UTR Luciferase Stable Cell Line

TU017357 1.0 ml
EUR 1394

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PALMD sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1590905 3 x 1.0 ug
EUR 376

PALMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV696061 1.0 ug DNA
EUR 682

PALMD Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV696065 1.0 ug DNA
EUR 682

PALMD Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV696066 1.0 ug DNA
EUR 682

PALMD sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1590906 1.0 ug DNA
EUR 167

PALMD sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1590907 1.0 ug DNA
EUR 167

PALMD sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1590908 1.0 ug DNA
EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Palmd sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7478205 3 x 1.0 ug
EUR 376

Palmd sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3768805 3 x 1.0 ug
EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

PALMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV696062 1.0 ug DNA
EUR 682

PALMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV696063 1.0 ug DNA
EUR 740

PALMD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV696064 1.0 ug DNA
EUR 740

Palmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7478206 1.0 ug DNA
EUR 167

Palmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7478207 1.0 ug DNA
EUR 167

Palmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7478208 1.0 ug DNA
EUR 167

Palmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3768806 1.0 ug DNA
EUR 167

Palmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3768807 1.0 ug DNA
EUR 167

Palmd sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3768808 1.0 ug DNA
EUR 167

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit

ELA-E0121h 96 Tests
EUR 824

Human KIT/SCFR ELISA kit

LF-EK50791 1×96T
EUR 648

KIT ELISA Kit (Human) (OKAN04574)

OKAN04574 96 Wells
EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)

OKCD06003 96 Wells
EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Pentosidine ELISA Kit

201-12-0005 96 tests
EUR 440
  • This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amylin ELISA Kit

201-12-0017 96 tests
EUR 440
  • This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human visfatin ELISA Kit

201-12-0026 96 tests
EUR 440
  • This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Secretin ELISA Kit

201-12-0027 96 tests
EUR 440
  • This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human PALMD(Palmdelphin) ELISA Kit