Human MLH1(MutL Homolog 1) ELISA Kit

To Order: Contact us

Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-96T 96T
EUR 673
  • Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
RD-MLH1-Hu-48Tests 48 Tests
EUR 521
Human MutL Homolog 1 (MLH1) ELISA Kit
RD-MLH1-Hu-96Tests 96 Tests
EUR 723
Human MutL Homolog 1 (MLH1) ELISA Kit
RDR-MLH1-Hu-48Tests 48 Tests
EUR 544
Human MutL Homolog 1 (MLH1) ELISA Kit
RDR-MLH1-Hu-96Tests 96 Tests
EUR 756
MLH1 (MutL Homolog 1)
MO47010 100 ul
EUR 349
Human MutL Homolog 1 (MLH1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human MutL Homolog 1 ELISA Kit (MLH1)
RK01858 96 Tests
EUR 521
Human MutL Homolog 1 (MLH1) ELISA Kit
SEJ742Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
SEJ742Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
SEJ742Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
SEJ742Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 1 (MLH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 1 (MLH1) in tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 1 (MLH1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as MutL Homolog 1 elisa. Alternative names of the recognized antigen: COCA2
  • FCC2
  • HNPCC2
  • hMLH1
  • DNA mismatch repair protein Mlh1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
MutL Homolog 1 (MLH1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx012221-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx025515-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx026385-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx026385-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 119.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 20 ug
  • 300 µg
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
MutL Homolog 1 (MLH1) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
MutL Homolog 1 (MLH1) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody
abx235213-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Human MutL Homolog 1 (MLH1) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human MutL Homolog 1 (MLH1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human MLH1 (MutL Homolog 1)
ELK4307 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to MutL Homolog 1 (MLH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to MutL Homolog
  • Show more
Description: A sandwich ELISA kit for detection of MutL Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
MutL Homolog 1 (MLH1) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 1 (MLH1) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Human MutL Homolog 3 (MLH3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human MutL Homolog 3 (MLH3) ELISA Kit
SEL736Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 3 (MLH3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 3 (MLH3) in Tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 3 (MLH3) ELISA Kit
SEL736Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 3 (MLH3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 3 (MLH3) in Tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 3 (MLH3) ELISA Kit
SEL736Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 3 (MLH3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 3 (MLH3) in Tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 3 (MLH3) ELISA Kit
SEL736Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutL Homolog 3 (MLH3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutL Homolog 3 (MLH3) in Tissue homogenates, cell lysates and other biological fluids.
Human MutL Homolog 3 (MLH3) ELISA Kit
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as MutL Homolog 3 elisa. Alternative names of the recognized antigen: HNPCC7
  • DNA mismatch repair protein Mlh3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MutL Homolog 3 (MLH3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
ELISA kit for Human MLH3 (MutL Homolog 3)
ELK7522 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to MutL Homolog 3 (MLH3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to MutL Homolog
  • Show more
Description: A sandwich ELISA kit for detection of MutL Homolog 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Mlh1/ Rat Mlh1 ELISA Kit
ELI-43715r 96 Tests
EUR 886
Human MutL Homolog 3 (MLH3) CLIA Kit
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
EF000813 96 Tests
EUR 689
MutL Homolog 3 (MLH3) Antibody
abx146077-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
abx331047-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
MutL Homolog 3 (MLH3) Antibody
abx432972-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
Human DNA mismatch repair protein Mlh1, MLH1 ELISA KIT
ELI-45580h 96 Tests
EUR 824
MLH1 ELISA Kit (Human) (OKAN06135)
OKAN06135 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC).;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL
MLH1 ELISA Kit (Human) (OKCD09218)
OKCD09218 96 Wells
EUR 975
Description: Description of target: This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC.This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Alternatively spliced transcript variants encoding different isoforms have been described, but their full-length natures have not been determined. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL
MLH1 ELISA Kit (Human) (OKDD00392)
OKDD00392 96 Wells
EUR 975
Description: Description of target: This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL
Mouse DNA mismatch repair protein Mlh1, Mlh1 ELISA KIT
ELI-13052m 96 Tests
EUR 865
mutL Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MLH1 Antibody
BF0073 200ul
EUR 376
Description: MLH1 antibody detects endogenous levels of total MLH1.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MLH1 antibody
70R-50061 100 ul
EUR 244
Description: Purified Polyclonal MLH1 antibody
MLH1 antibody
70R-5690 50 ug
EUR 467
Description: Rabbit polyclonal MLH1 antibody
MLH1 antibody
70R-33833 100 ug
EUR 327
Description: Rabbit polyclonal MLH1 antibody
MLH1 Antibody
ABD3621 100 ug
EUR 438
MLH1 Antibody
ABD6057 100 ug
EUR 438
MLH1 Antibody
35518-100ul 100ul
EUR 390
MLH1 Antibody
48713-100ul 100ul
EUR 333
MLH1 Antibody
48713-50ul 50ul
EUR 239
MLH1 Antibody
32046-100ul 100ul
EUR 252
MLH1 antibody
10R-1841 100 ul
EUR 403
Description: Mouse monoclonal MLH1 antibody
MLH1 antibody
70R-18532 50 ul
EUR 435
Description: Rabbit polyclonal MLH1 antibody
MLH1 Antibody
DF6057 200ul
EUR 304
Description: MLH1 Antibody detects endogenous levels of total MLH1.
MLH1 Antibody
DF3621 200ul
EUR 304
Description: MLH1 Antibody detects endogenous levels of total MLH1.
MLH1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MLH1. Recognizes MLH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000
MLH1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MLH1. Recognizes MLH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
MLH1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MLH1. Recognizes MLH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
MLH1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MLH1. Recognizes MLH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
MLH1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MLH1. Recognizes MLH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
MLH1 Antibody
P1029-01m 0.1m
EUR 231
MLH1 Antibody
P1029-1ml 1ml
EUR 738
DNA Mismatch Repair Protein MutL (mutL) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Human MLH1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MLH1 Recombinant Protein (Human)
RP019561 100 ug Ask for price
Anti-Human MLH1 antibody
STJ16100394 1 mL
EUR 996
DNA Mismatch Repair Protein Mlh1 (MLH1) Antibody
abx159610-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
DNA Mismatch Repair Protein MutL (MUTL) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DNA Mismatch Repair Protein MutL (MUTL) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DNA Mismatch Repair Protein MutL (MUTL) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Escherichia coli DNA mismatch repair protein MutL (mutL)
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 71.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli DNA mismatch repair protein MutL(mutL) expressed in E.coli
MLH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1307602 1.0 ug DNA
EUR 154
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Human Notch Homolog 1 ELISA kit
E01N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Notch Homolog 1 ELISA kit
E01N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Notch Homolog 1 ELISA kit
E01N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monoclonal MLH1 Antibody
AMM01831G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human MLH1. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, IF, E
Monoclonal MLH1 Antibody
AMM03188G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human MLH1. The antibodies are raised in Mouse. This antibody is applicable in WB
MLH1 Blocking Peptide
BF0073-BP 1mg
EUR 195
MLH1 Conjugated Antibody
C32046 100ul
EUR 397
MLH1 cloning plasmid
CSB-CL014624HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2271
  • Sequence: atgtcgttcgtggcaggggttattcggcggctggacgagacagtggtgaaccgcatcgcggcgggggaagttatccagcggccagctaatgctatcaaagagatgattgagaactgtttagatgcaaaatccacaagtattcaagtgattgttaaagagggaggcctgaagttga
  • Show more
Description: A cloning plasmid for the MLH1 gene.
MLH1 Polyclonal Antibody
ES2797-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MLH1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
MLH1 Polyclonal Antibody
ES2797-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MLH1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
anti- MLH1 antibody
FNab05213 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: MutL protein homolog 1
  • Uniprot ID: P40692
  • Gene ID: 4292
  • Research Area: Cancer, Immunology, Metabolism, Developmental biology
Description: Antibody raised against MLH1
MLH1 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
MLH1 Polyclonal Antibody
ABP51798-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human MLH1 at AA range: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of MLH1 from Human, Mouse, Rat. This MLH1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MLH1 at AA range: 410-490
MLH1 Polyclonal Antibody
ABP51798-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human MLH1 at AA range: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of MLH1 from Human, Mouse, Rat. This MLH1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MLH1 at AA range: 410-490
MLH1 Polyclonal Antibody
ABP51798-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human MLH1 at AA range: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of MLH1 from Human, Mouse, Rat. This MLH1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MLH1 at AA range: 410-490
MLH1 Rabbit pAb
A0254-100ul 100 ul
EUR 308
MLH1 Rabbit pAb
A0254-200ul 200 ul
EUR 459
MLH1 Rabbit pAb
A0254-20ul 20 ul
EUR 183
MLH1 Rabbit pAb
A0254-50ul 50 ul
EUR 223
Anti-MLH1 Antibody
EUR 479
MLH1 Blocking Peptide
33R-6109 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MLH1 antibody, catalog no. 70R-5690
MLH1 Monoclonal Antibody
27214-100ul 100ul
EUR 252
MLH1 Monoclonal Antibody
27214-50ul 50ul
EUR 187
MLH1 Blocking Peptide
DF6057-BP 1mg
EUR 195
MLH1 Blocking Peptide
DF3621-BP 1mg
EUR 195
Anti-MLH1 Antibody
PB9724 100ug/vial
EUR 294
Anti-MLH1 antibody
PAab05213 100 ug
EUR 355
anti-MLH1 (4C9C7)
LF-MA30201 100 ul
EUR 486
Description: Mouse Monoclonal to MLH1
PVT12600 2 ug
EUR 391
Anti-MLH1 antibody
STJ94145 200 µl
EUR 197
Description: Rabbit polyclonal to MLH1.
Anti-MLH1 antibody
STJ98245 100 µl
EUR 234
Description: Mouse monoclonal to MLH1.
Anti-MLH1 antibody
STJ99207 200 µl
EUR 197
Description: Mouse monoclonal to MLH1.
Anti-MLH1 antibody
STJ24563 100 µl
EUR 277
Description: This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.
Anti-MLH1 antibody
STJ160112 1 mL C
EUR 589
Anti-MLH1 (M1)
YF-MA10574 100 ug
EUR 363
Description: Mouse monoclonal to MLH1
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
MLH1 ORF Vector (Human) (pORF)
ORF006521 1.0 ug DNA
EUR 95
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
mutL Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is HRP conjugated. Tested in the following application: ELISA
mutL Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is FITC conjugated. Tested in the following application: ELISA
mutL Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mutL. Recognizes mutL from Escherichia coli. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1 96 Well Plate
EUR 417
Human Complexin-1 AssayMax ELISA Kit
EC3505-1 96 Well Plate
EUR 417
Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1 96 Well Plate
EUR 477
Recombinant Salmonella mutL Protein (aa 1-618)
VAng-Wyb1146-inquire inquire Ask for price
Description: Salmonella agona (strain SL483) DNA mismatch repair protein mutL, recombinant protein.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Human Dachshund Homolog 1 (DACH1) ELISA Kit
abx556324-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Human Roundabout homolog 1 (ROBO1) ELISA Kit
abx556329-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Frizzled Homolog 1 (FZD1) ELISA Kit
abx571378-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human MLH1(MutL Homolog 1) ELISA Kit