Human LEPREL1(Leprecan Like Protein 1) ELISA Kit

To Order: Contact us

Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
EUR 673
  • Should the Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
RDR-LEPREL1-Hu-48Tests 48 Tests
EUR 544
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
RDR-LEPREL1-Hu-96Tests 96 Tests
EUR 756
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
RD-LEPREL1-Hu-48Tests 48 Tests
EUR 521
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
RD-LEPREL1-Hu-96Tests 96 Tests
EUR 723
Human Leprecan Like Protein 1 (LEPREL1)ELISA Kit
201-12-2787 96 tests
EUR 440
  • This Leprecan Like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Leprecan Like Protein 1(LEPREL1)ELISA Kit
QY-E01994 96T
EUR 361
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
SEH747Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
SEH747Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
SEH747Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
SEH747Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Leprecan Like Protein 1 (LEPREL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Leprecan Like Protein 1 (LEPREL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Leprecan Like Protein 1 (LEPREL1) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Leprecan Like Protein 1 elisa. Alternative names of the recognized antigen: MLAT4
  • P3H2
  • Prolyl 3-Hydroxylase 2
  • Myxoid liposarcoma-associated protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Leprecan Like Protein 1 (LEPREL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Leprecan-Like 1 (LEPREL1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Leprecan Like Protein 1 (LEPREL1) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Leprecan Like Protein 1 (LEPREL1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Human Leprecan Like Protein 1 (LEPREL1) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Leprecan Like Protein 1 (LEPREL1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human LEPREL1 (Leprecan Like Protein 1)
ELK4246 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Leprecan Like Protein 1 (LEPREL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Leprecan Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Leprel1/ Rat Leprel1 ELISA Kit
ELI-23285r 96 Tests
EUR 886
Leprecan-Like 2 (LEPREL2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
EF010657 96 Tests
EUR 689
Leprecan-1 (LEPRE1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
LEPREL1 (LEPREL1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
LEPREL1 (LEPREL1) Antibody
abx036203-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
LEPREL1 (LEPREL1) Antibody
abx234752-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
LEPREL1 ELISA Kit (Human) (OKCD09090)
OKCD09090 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL
LEPREL1 ELISA Kit (Human) (OKDD00376)
OKDD00376 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1 96 Well Plate
EUR 477
LEPREL1 antibody
70R-18252 50 ul
EUR 435
Description: Rabbit polyclonal LEPREL1 antibody
LEPREL1 Antibody
39880-100ul 100ul
EUR 390
LEPREL1 antibody
70R-35573 100 ug
EUR 349
Description: Purified Rabbit polyclonal LEPREL1 antibody
LEPREL1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LEPREL1. Recognizes LEPREL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VSNL1 Visinin-Like Protein-1 Human Recombinant Protein
PROTP62760-1 Regular: 50ug
EUR 317
Description: VSNL1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 191 amino acids (1-191 a.a.) and having a molecular mass of 22.1kDa.;The VSNL1 is purified by proprietary chromatographic techniques.
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
Human LEPREL1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
Human Prolyl 3- hydroxylase 2, LEPREL1 ELISA KIT
ELI-46600h 96 Tests
EUR 824
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
DLK1 Human, Delta-Like 1 Human Recombinant Protein, HEK
PROTP80370-1 Regular: 10ug
EUR 317
Description: DLK1 Human Recombinant produced in HEK293 Cells is a single, glycosylated, polypeptide chain (a.a 24-303) containing 290 amino acids including a 10 a.a C-terminal His tag. The total molecular mass is 31.2kDa (calculated). 
FSTL1 Human, Follistatin Like 1 Human Recombinant Protein, HEK
PROTQ12841-1 Regular: 10ug
EUR 317
Description: FSTL1 Human Recombinant produced in HEK293 cells is a single, glycosylated polypeptide chain (a.a 21-308) containing 296 amino acids including a 8 a.a C-terminal His tag. The total molecular mass is 33.8kDa (calculated).
IL1RL1 Human, Interleukin-1 Receptor Like-1 Human Recombinant Protein, Sf9
PROTQ01638-1 Regular: 10ug
EUR 317
Description: IL 1RL1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (19-328 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 318 amino acids and having a molecular mass of 36.0kDa.;IL 1RL1 shows multiple bands between 40-57kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EMI1001-1 96 Well Plate
EUR 477
LEPREL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1208502 1.0 ug DNA
EUR 154
LEPREL1 Polyclonal Antibody
31430-100ul 100ul
EUR 252
LEPREL1 Polyclonal Antibody
31430-50ul 50ul
EUR 187
LEPREL1 cloning plasmid
CSB-CL815555HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: atggaaatgcagcagaacattgagaattacagggcgacagctggtgttgaagcattgcagttggtagacagagaagccaagccacacatggagagttacaatgcaggagttaaacattatgaggctgatgactttgagatggctatcaggcatttcgaacaagccttaagagaat
  • Show more
Description: A cloning plasmid for the LEPREL1 gene.
LEPREL1 Rabbit pAb
A8068-100ul 100 ul
EUR 308
LEPREL1 Rabbit pAb
A8068-200ul 200 ul
EUR 459
LEPREL1 Rabbit pAb
A8068-20ul 20 ul
EUR 183
LEPREL1 Rabbit pAb
A8068-50ul 50 ul
EUR 223
anti- LEPREL1 antibody
FNab04752 100µg
EUR 548.75
  • Immunogen: leprecan-like 1
  • Uniprot ID: Q8IVL5
  • Research Area: Signal Transduction, Neuroscience
Description: Antibody raised against LEPREL1
Anti-LEPREL1 antibody
PAab04752 100 ug
EUR 386
Anti-LEPREL1 antibody
STJ110371 100 µl
EUR 277
Description: This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
GLP-1 Glucagon Like Peptide-1 (31 a.a.) Human Recombinant Protein
PROTP01275-1 Regular: 50ug
EUR 317
Description: Glucagon Like Peptide-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 31 amino acids and having a molecular mass of 3298.7 Dalton. The GLP-1 is purified by proprietary chromatographic techniques.
ELISA kit for Human Prolyl 3-hydroxylase 2 (LEPREL1)
KTE61831-48T 48T
EUR 332
  • LEPREL1 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly. The deduced 708-amino acid protein has an N-terminal signal peptide, 4 tetratricopeptide repeats, 4 CxxxC motifs, a central
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl 3-hydroxylase 2 (LEPREL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Prolyl 3-hydroxylase 2 (LEPREL1)
KTE61831-5platesof96wells 5 plates of 96 wells
EUR 2115
  • LEPREL1 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly. The deduced 708-amino acid protein has an N-terminal signal peptide, 4 tetratricopeptide repeats, 4 CxxxC motifs, a central
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl 3-hydroxylase 2 (LEPREL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Prolyl 3-hydroxylase 2 (LEPREL1)
KTE61831-96T 96T
EUR 539
  • LEPREL1 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly. The deduced 708-amino acid protein has an N-terminal signal peptide, 4 tetratricopeptide repeats, 4 CxxxC motifs, a central
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl 3-hydroxylase 2 (LEPREL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
TINAGL1 Human, Tubulointerstitial Nephritis Antigen Like 1 Human Recombinant Protein, Sf9
PROTQ9GZM7-1 Regular: 5ug
EUR 317
Description: TINAGL1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 455 amino acids (22-467a.a.) and having a molecular mass of 51.2kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TINAGL1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
LEPREL1 ORF Vector (Human) (pORF)
ORF005897 1.0 ug DNA
EUR 95
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Anti-Vangl1/Vang Like Protein 1 Antibody
A07587-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Vangl1 Antibody (VANGL1) detection. Tested with WB in Human, Mouse.
Anti-Visinin-like Protein 1 Monoclonal Antibody
M06959-1 100ul
EUR 397
Description: Mouse Monoclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
LEPREL1 Protein Vector (Human) (pPB-C-His)
PV023585 500 ng
EUR 329
LEPREL1 Protein Vector (Human) (pPB-N-His)
PV023586 500 ng
EUR 329
LEPREL1 Protein Vector (Human) (pPM-C-HA)
PV023587 500 ng
EUR 329
LEPREL1 Protein Vector (Human) (pPM-C-His)
PV023588 500 ng
EUR 329
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1 96 Well Plate
EUR 477
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
Chicken Prolyl 3- hydroxylase 2, LEPREL1 ELISA KIT
ELI-35731c 96 Tests
EUR 928
Mouse Prolyl 3- hydroxylase 2, Leprel1 ELISA KIT
ELI-35732m 96 Tests
EUR 865
Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Follistatin Like Protein 1 ELISA kit
E01F0385-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Follistatin Like Protein 1 ELISA kit
E01F0385-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Follistatin Like Protein 1 ELISA kit
E01F0385-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tolloid Like Protein 1 ELISA kit
E01T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tolloid Like Protein 1 ELISA kit
E01T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tolloid Like Protein 1 ELISA kit
E01T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human LEPREL1(Leprecan Like Protein 1) ELISA Kit