Human KYNU(Kynureninase) ELISA Kit

To Order: Contact us

Human Kynureninase (KYNU) ELISA Kit
EUR 673
  • Should the Human Kynureninase (KYNU) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kynureninase (KYNU) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Kynureninase (KYNU) ELISA Kit
RDR-KYNU-Hu-48Tests 48 Tests
EUR 544
Human Kynureninase (KYNU) ELISA Kit
RDR-KYNU-Hu-96Tests 96 Tests
EUR 756
Human Kynureninase (KYNU) ELISA Kit
RD-KYNU-Hu-48Tests 48 Tests
EUR 521
Human Kynureninase (KYNU) ELISA Kit
RD-KYNU-Hu-96Tests 96 Tests
EUR 723
Human Kynureninase (KYNU)
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 61.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Kynureninase(KYNU) expressed in E.coli
Human Kynureninase (KYNU) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human KYNU/ Kynureninase ELISA Kit
E1412Hu 1 Kit
EUR 605
Human KYNU(Kynureninase) ELISA Kit
EH1193 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q16719
  • Alias: KYNU/kynureninase/L-kynurenine hydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Kynureninase, KYNU ELISA KIT
ELI-14441h 96 Tests
EUR 824
Human Kynureninase (KYNU) ELISA Kit
abx571684-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Kynureninase(KYNU)ELISA Kit
QY-E01800 96T
EUR 361
Human Kynureninase ELISA Kit (KYNU)
RK01751 96 Tests
EUR 521
Human Kynureninase (KYNU) ELISA Kit
SED762Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids.
Human Kynureninase (KYNU) ELISA Kit
SED762Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids.
Human Kynureninase (KYNU) ELISA Kit
SED762Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids.
Human Kynureninase (KYNU) ELISA Kit
SED762Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynureninase (KYNU) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynureninase (KYNU) in Tissue homogenates, cell lysates and other biological fluids.
Human Kynureninase (KYNU) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kynureninase elisa. Alternative names of the recognized antigen: L-Kynurenine Hydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kynureninase (KYNU) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Kynureninase (KYNU) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kynureninase (KYNU) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Kynureninase (KYNU) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kynureninase (KYNU) Antibody
abx122988-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Kynureninase (KYNU) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kynureninase (KYNU) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Kynureninase (KYNU) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kynureninase (KYNU) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Kynureninase (KYNU) Antibody
abx234667-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Kynureninase (KYNU) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse Kynu/ Kynureninase ELISA Kit
E0844Mo 1 Kit
EUR 632
Mouse Kynureninase, Kynu ELISA KIT
ELI-23328m 96 Tests
EUR 865
Mouse Kynureninase (KYNU) ELISA Kit
abx514933-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Rat Kynureninase (KYNU) ELISA Kit
abx514934-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
ELISA kit for Human KYNU (Kynureninase)
ELK4508 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kynureninase (KYNU). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kynureninase (
  • Show more
Description: A sandwich ELISA kit for detection of Kynureninase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Kynureninase (KYNU) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Kynureninase (KYNU) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Kynureninase (KYNU) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Kynureninase (KYNU) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Kynureninase (KYNU) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Kynu ELISA Kit| Rat Kynureninase ELISA Kit
EF018890 96 Tests
EUR 689
Kynu ELISA Kit| Mouse Kynureninase ELISA Kit
EF015331 96 Tests
EUR 689
Kynu/ Rat Kynu ELISA Kit
ELI-47987r 96 Tests
EUR 886
ELISA kit for Human Kynureninase
EK2659 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kynureninase in samples from serum, plasma, tissue homogenates and other biological fluids.
ELA-E10551h 96 Tests
EUR 824
EF002573 96 Tests
EUR 689
Human Kynurenine ( KYNU) ELISA Kit
QY-E05349 96T
EUR 374
KYNU ELISA Kit (Human) (OKAN05641)
OKAN05641 96 Wells
EUR 792
Description: Description of target: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL
KYNU ELISA Kit (Human) (OKCD08531)
OKCD08531 96 Wells
EUR 975
Description: Description of target: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway.Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Two transcript variants encoding different isoforms have been found for this gene.Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL
KYNU ELISA Kit (Human) (OKEH02100)
OKEH02100 96 Wells
EUR 662
Description: Description of target: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL
ELISA kit for Rat Kynureninase
EK2660 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Kynureninase in samples from serum, plasma, tissue homogenates and other biological fluids.
Kynureninase, CF
PR15077CF 10 ug
EUR 435
KYNU ELISA Kit (Rat) (OKEH03595)
OKEH03595 96 Wells
EUR 779
Description: Description of target: Catalyzes the cleavage of L-kynurenine (L-Kyn) and L-3-hydroxykynurenine (L-3OHKyn) into anthranilic acid (AA) and 3-hydroxyanthranilic acid (3-OHAA), respectively. Has a preference for the L-3-hydroxy form. Also has cysteine-conjugate-beta-lyase activity.UniRule annotation;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.159 ng/mL
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
KYNU antibody
22336-100ul 100ul
EUR 390
KYNU antibody
70R-18198 50 ul
EUR 435
Description: Rabbit polyclonal KYNU antibody
KYNU antibody
70R-1261 100 ug
EUR 377
Description: Rabbit polyclonal KYNU antibody
KYNU antibody
70R-13640 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal KYNU antibody
KYNU antibody
39066-100ul 100ul
EUR 252
KYNU Antibody
43079-100ul 100ul
EUR 252
KYNU Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000
KYNU Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000
KYNU Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
KYNU antibody
70R-3487 50 ug
EUR 467
Description: Rabbit polyclonal KYNU antibody
KYNU Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human KYNU shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KYNU Recombinant Protein (Human)
RP017440 100 ug Ask for price
KYNU Blocking Peptide
33R-4774 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KYNU antibody, catalog no. 70R-3487
KYNU Blocking Peptide
33R-5947 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KYNU antibody, catalog no. 70R-1261
KYNU Conjugated Antibody
C43079 100ul
EUR 397
KYNU Conjugated Antibody
C39066 100ul
EUR 397
KYNU cloning plasmid
CSB-CL621970HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 924
  • Sequence: atggagccttcatctcttgagctgccggctgacacagtgcagcgcattgcggctgaactcaaatgccacccaacggatgagagggtggctctccacctagatgaggaagataagctgaggcacttcagggagtgcttttatattcccaaaatacaggatctgcctccagttgattt
  • Show more
Description: A cloning plasmid for the KYNU gene.
KYNU Rabbit pAb
A6643-100ul 100 ul
EUR 308
KYNU Rabbit pAb
A6643-200ul 200 ul
EUR 459
KYNU Rabbit pAb
A6643-20ul 20 ul
EUR 183
KYNU Rabbit pAb
A6643-50ul 50 ul
EUR 223
anti- KYNU antibody
FNab04667 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: kynureninase (L-kynurenine hydrolase)
  • Uniprot ID: Q16719
  • Gene ID: 8942
  • Research Area: Metabolism
Description: Antibody raised against KYNU
Anti-KYNU antibody
PAab04667 100 ug
EUR 355
PVT12821 2 ug
EUR 391
Anti-KYNU antibody
STJ28726 100 µl
EUR 277
Description: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants.
KYNU ORF Vector (Human) (pORF)
ORF005814 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
KYNU Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
KYNU Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
KYNU Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KYNU. Recognizes KYNU from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse KYNU shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat KYNU shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KYNU Recombinant Protein (Rat)
RP207719 100 ug Ask for price
KYNU Recombinant Protein (Mouse)
RP146726 100 ug Ask for price
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
KYNU sgRNA CRISPR Lentivector set (Human)
K1191501 3 x 1.0 ug
EUR 339
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Kynu ORF Vector (Rat) (pORF)
ORF069241 1.0 ug DNA
EUR 506
Kynu ORF Vector (Mouse) (pORF)
ORF048910 1.0 ug DNA
EUR 506
KYNU sgRNA CRISPR Lentivector (Human) (Target 1)
K1191502 1.0 ug DNA
EUR 154
KYNU sgRNA CRISPR Lentivector (Human) (Target 2)
K1191503 1.0 ug DNA
EUR 154
KYNU sgRNA CRISPR Lentivector (Human) (Target 3)
K1191504 1.0 ug DNA
EUR 154
KYNU Protein Vector (Human) (pPB-C-His)
PV023253 500 ng
EUR 329
KYNU Protein Vector (Human) (pPB-N-His)
PV023254 500 ng
EUR 329
KYNU Protein Vector (Human) (pPM-C-HA)
PV023255 500 ng
EUR 329
KYNU Protein Vector (Human) (pPM-C-His)
PV023256 500 ng
EUR 329
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
EUR 153
  • Category: Cas9

Human KYNU(Kynureninase) ELISA Kit