Human DPEP2(Dipeptidase 2) ELISA Kit

To Order: Contact us

Human Dipeptidase 2 (DPEP2) ELISA Kit

RDR-DPEP2-Hu-96Tests 96 Tests
EUR 756

Human Dipeptidase 2 (DPEP2) ELISA Kit

RD-DPEP2-Hu-48Tests 48 Tests
EUR 521

Human Dipeptidase 2 (DPEP2) ELISA Kit

RD-DPEP2-Hu-96Tests 96 Tests
EUR 723

Human Dipeptidase 2 (DPEP2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dipeptidase 2, DPEP2 ELISA KIT

ELI-47804h 96 Tests
EUR 824

Human Dipeptidase 2(DPEP2)ELISA Kit

QY-E03687 96T
EUR 361

Human Dipeptidase 2 (DPEP2) ELISA Kit

SEF386Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids.

Human Dipeptidase 2 (DPEP2) ELISA Kit

SEF386Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids.

Human Dipeptidase 2 (DPEP2) ELISA Kit

SEF386Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids.

Human Dipeptidase 2 (DPEP2) ELISA Kit

SEF386Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 2 (DPEP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 2 (DPEP2) in Tissue homogenates, cell lysates and other biological fluids.

Human Dipeptidase 2 (DPEP2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dipeptidase 2 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidase 2 (DPEP2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Dipeptidase 2, Dpep2 ELISA KIT

ELI-09175m 96 Tests
EUR 865

Dipeptidase 2 (DPEP2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Dipeptidase 2 (DPEP2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dipeptidase 2 (DPEP2) Antibody

abx122092-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dipeptidase 2 (DPEP2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dipeptidase 2 (DPEP2) Antibody

abx232514-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Dipeptidase 2 (DPEP2)

  • EUR 350.88
  • EUR 197.00
  • EUR 1040.80
  • EUR 413.60
  • EUR 727.20
  • EUR 298.00
  • EUR 2452.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H4A9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dipeptidase 2 expressed in: E.coli

ELISA kit for Human DPEP2 (Dipeptidase 2)

ELK4595 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dipeptidase 2 (DPEP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dipeptidase
  • Show more
Description: A sandwich ELISA kit for detection of Dipeptidase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Dipeptidase 2 (DPEP2)

KTE61986-48T 48T
EUR 332
  • DPEP2 belongs to the membrane-bound dipeptidase (EC family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathio
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 2 (DPEP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dipeptidase 2 (DPEP2)

KTE61986-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DPEP2 belongs to the membrane-bound dipeptidase (EC family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathio
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 2 (DPEP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dipeptidase 2 (DPEP2)

KTE61986-96T 96T
EUR 539
  • DPEP2 belongs to the membrane-bound dipeptidase (EC family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathio
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 2 (DPEP2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Dipeptidase 2 (DPEP2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Dipeptidase 2 (DPEP2) Protein

  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPEP2 (Leu303~Leu486)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2)

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPEP2 (Leu303~Leu486)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with APC.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPEP2 (Leu303~Leu486)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with Biotin.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPEP2 (Leu303~Leu486)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with Cy3.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPEP2 (Leu303~Leu486)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with FITC.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPEP2 (Leu303~Leu486)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with HRP.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPEP2 (Leu303~Leu486)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with PE.

Dipeptidase 2 (DPEP2) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DPEP2 (Leu303~Leu486)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Dipeptidase 2 (DPEP2). This antibody is labeled with APC-Cy7.

Dpep2/ Rat Dpep2 ELISA Kit

ELI-46906r 96 Tests
EUR 886


EF009209 96 Tests
EUR 689

DPEP2 ELISA Kit (Human) (OKCD00464)

OKCD00464 96 Wells
EUR 831
Description: Description of target: Probable metalloprotease which hydrolyzes leukotriene D4 (LTD4) into leukotriene E4 (LTE4).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.069 ng/mL

DPEP2 ELISA Kit (Human) (OKDD00240)

OKDD00240 96 Wells
EUR 975
Description: Description of target: DPEP2 belongs to the membrane-bound dipeptidase (EC family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathione degradation (Habib et al., 2003 [PubMed 12738806]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.069 ng/mL

Human Carnosine Dipeptidase 2(CNDP2)ELISA Kit

QY-E03018 96T
EUR 400

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Dipeptidase 3 (DPEP3) ELISA Kit

DLR-DPEP3-Hu-48T 48T
EUR 517
  • Should the Human Dipeptidase 3 (DPEP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 3 (DPEP3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit

DLR-DPEP3-Hu-96T 96T
EUR 673
  • Should the Human Dipeptidase 3 (DPEP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 3 (DPEP3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dipeptidase 1(DPEP1) ELISA kit

E01D0293-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidase 1(DPEP1) ELISA kit

E01D0293-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidase 1(DPEP1) ELISA kit

E01D0293-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dipeptidase 3 (DPEP3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

ELISA kit for Human Dipeptidase 1

EK5021 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Dipeptidase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human DPEP1(Dipeptidase 1) ELISA Kit

EH2498 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P16444
  • Alias: DPEP1/Renal dipeptidase/hRDP/Dehydropeptidase-I/Microsomal dipeptidase/MDP/RDP
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human DPEP1/ Dipeptidase 1 ELISA Kit

E0722Hu 1 Kit
EUR 605

Human Dipeptidase 1(DPEP1) ELISA kit

CSB-EL007123HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Dipeptidase 1 (DPEP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Dipeptidase 1(DPEP1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Dipeptidase 1(DPEP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Dipeptidase 1, DPEP1 ELISA KIT

ELI-31993h 96 Tests
EUR 824

Human Dipeptidase 3, DPEP3 ELISA KIT

ELI-31994h 96 Tests
EUR 824

Human Dipeptidase 3(DPEP3)ELISA Kit

QY-E03686 96T
EUR 361

Human Dipeptidase 3 (DPEP3) ELISA Kit

RDR-DPEP3-Hu-48Tests 48 Tests
EUR 544

Human Dipeptidase 3 (DPEP3) ELISA Kit

RDR-DPEP3-Hu-96Tests 96 Tests
EUR 756

Human Dipeptidase 3 (DPEP3) ELISA Kit

SEF387Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit

SEF387Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit

SEF387Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit

SEF387Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 3 (DPEP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 3 (DPEP3) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 3 (DPEP3) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dipeptidase 3 elisa. Alternative names of the recognized antigen: MBD3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidase 3 (DPEP3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Dipeptidase 3 (DPEP3) ELISA Kit

RD-DPEP3-Hu-48Tests 48 Tests
EUR 521

Human Dipeptidase 3 (DPEP3) ELISA Kit

RD-DPEP3-Hu-96Tests 96 Tests
EUR 723

DPEP2 Antibody

DF12958 200ul
EUR 304
Description: DPEP2 Antibody detects endogenous levels of DPEP2.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA20473 50 ul
EUR 363
Description: Mouse polyclonal to DPEP2

DPEP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0626603 1.0 ug DNA
EUR 154

Human DPEP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPEP2 Recombinant Protein (Human)

RP009733 100 ug Ask for price

Human CNDP Dipeptidase 2 (CNDP2) Antibody

32157-05111 150 ug
EUR 261


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

DLR-CNDP1-Hu-48T 48T
EUR 517
  • Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

DLR-CNDP1-Hu-96T 96T
EUR 673
  • Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

DLR-DPEP1-Hu-48T 48T
EUR 517
  • Should the Human Dipeptidase 1, Renal (DPEP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 1, Renal (DPEP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

DLR-DPEP1-Hu-96T 96T
EUR 673
  • Should the Human Dipeptidase 1, Renal (DPEP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dipeptidase 1, Renal (DPEP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Xaa-Pro dipeptidase (PEPD) ELISA Kit

abx251813-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Human Xaa-Pro dipeptidase

EK4921 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Xaa-Pro dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PEPD(Xaa-Pro dipeptidase) ELISA Kit

EH2449 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: P12955
  • Alias: PEPD/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human PEPD/ Xaa-Pro dipeptidase ELISA Kit

E1906Hu 1 Kit
EUR 605

Human Xaa- Pro dipeptidase, PEPD ELISA KIT

ELI-07707h 96 Tests
EUR 824

ELISA kit for Human DPEP3 (Dipeptidase 3)

ELK4127 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dipeptidase 3 (DPEP3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dipeptidase
  • Show more
Description: A sandwich ELISA kit for detection of Dipeptidase 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

abx571875-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Dipeptidase 1 (DPEP1)

KTE61987-48T 48T
EUR 332
  • DPEP1 (EC is a kidney membrane enzyme that hydrolyzes a variety of dipeptides and is implicated in renal metabolism of glutathione and its conjugates, e.g., leukotriene D4 (Kozak and Tate, 1982). DPEP1 is responsible for hydrolysis of the
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 1 (DPEP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dipeptidase 1 (DPEP1)

KTE61987-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DPEP1 (EC is a kidney membrane enzyme that hydrolyzes a variety of dipeptides and is implicated in renal metabolism of glutathione and its conjugates, e.g., leukotriene D4 (Kozak and Tate, 1982). DPEP1 is responsible for hydrolysis of the
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 1 (DPEP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dipeptidase 1 (DPEP1)

KTE61987-96T 96T
EUR 539
  • DPEP1 (EC is a kidney membrane enzyme that hydrolyzes a variety of dipeptides and is implicated in renal metabolism of glutathione and its conjugates, e.g., leukotriene D4 (Kozak and Tate, 1982). DPEP1 is responsible for hydrolysis of the
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dipeptidase 1 (DPEP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Carnosine Dipeptidase 1(CNDP1)ELISA Kit

QY-E03019 96T
EUR 400

Human Carnosine Dipeptidase 1 ELISA Kit (CNDP1)

RK01137 96 Tests
EUR 521

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RDR-CNDP1-Hu-48Tests 48 Tests
EUR 544

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RDR-CNDP1-Hu-96Tests 96 Tests
EUR 756

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

RDR-DPEP1-Hu-48Tests 48 Tests
EUR 544

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

RDR-DPEP1-Hu-96Tests 96 Tests
EUR 756

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

SEC441Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

SEC441Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

SEC441Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

SEC441Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dipeptidase 1, Renal (DPEP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dipeptidase 1, Renal (DPEP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dipeptidase 1, Renal elisa. Alternative names of the recognized antigen: RDP
  • MBD1
  • MDP
  • Dehydropeptidase-I
  • Microsomal dipeptidase
  • Renal dipeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dipeptidase 1, Renal (DPEP1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

SEF388Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

SEF388Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

SEF388Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

SEF388Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carnosine Dipeptidase 1 (CNDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carnosine Dipeptidase 1 (CNDP1) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Carnosine Dipeptidase 1 elisa. Alternative names of the recognized antigen: CN1
  • CPGL2
  • Beta-Ala-His Dipeptidase
  • Metallopeptidase M20
  • Carnosinase 1
  • Serum carnosinase
  • Glutamate Carboxypeptidase-Like Protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RD-CNDP1-Hu-48Tests 48 Tests
EUR 521

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RD-CNDP1-Hu-96Tests 96 Tests
EUR 723

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

RD-DPEP1-Hu-48Tests 48 Tests
EUR 521

Human Dipeptidase 1, Renal (DPEP1) ELISA Kit

RD-DPEP1-Hu-96Tests 96 Tests
EUR 723

DPEP2 Polyclonal Antibody

29311-100ul 100ul
EUR 252

DPEP2 Polyclonal Antibody

29311-50ul 50ul
EUR 187

DPEP2 Rabbit pAb

A15502-100ul 100 ul
EUR 308

DPEP2 Rabbit pAb

A15502-200ul 200 ul
EUR 459

DPEP2 Rabbit pAb

A15502-20ul 20 ul
EUR 183

DPEP2 Rabbit pAb

A15502-50ul 50 ul
EUR 223

DPEP2 Blocking Peptide

DF12958-BP 1mg
EUR 195

DPEP2 cloning plasmid

CSB-CL007124HU-10ug 10ug
EUR 446
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1200
  • Sequence: atgcagccctccggcctcgagggtcccggcacgtttggtcggtggcctctgctgagtctgctgctcctgctgctgctgctccagcctgtaacctgtgcctacaccacgccaggcccccccagagcccagttctggtcagcctatgtgccatgccagacccaggaccgggatgccc
  • Show more
Description: A cloning plasmid for the DPEP2 gene.

DPEP2 Rabbit pAb

A19500-100ul 100 ul Ask for price

DPEP2 Rabbit pAb

A19500-200ul 200 ul Ask for price

DPEP2 Rabbit pAb

A19500-20ul 20 ul Ask for price

DPEP2 Rabbit pAb

A19500-50ul 50 ul
EUR 308

anti- DPEP2 antibody

FNab02514 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: dipeptidase 2
  • Uniprot ID: Q9H4A9
  • Gene ID: 64174
  • Research Area: Metabolism
Description: Antibody raised against DPEP2

Anti-DPEP2 antibody

PAab02514 100 ug
EUR 355

Anti-DPEP2 antibody

STJ11100693 50 µl
EUR 287
Description: NA

Anti-DPEP2 antibody

STJ117697 100 µl
EUR 277

Rat Dipeptidase 1(DPEP1) ELISA kit

E02D0293-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dipeptidase 1(DPEP1) ELISA kit

E02D0293-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dipeptidase 1(DPEP1) ELISA kit

E02D0293-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dpep1/ Dipeptidase 1 ELISA Kit

E0302Ra 1 Kit
EUR 646

Mouse Dipeptidase 1(DPEP1) ELISA kit

E03D0293-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dipeptidase 1(DPEP1) ELISA kit

E03D0293-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dipeptidase 1(DPEP1) ELISA kit

E03D0293-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dpep1/ Dipeptidase 1 ELISA Kit

E0419Mo 1 Kit
EUR 632

Goat Dipeptidase 1(DPEP1) ELISA kit

E06D0293-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dipeptidase 1(DPEP1) ELISA kit

E06D0293-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dipeptidase 1(DPEP1) ELISA kit

E06D0293-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dipeptidase 1(DPEP1) ELISA kit

E04D0293-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dipeptidase 1(DPEP1) ELISA kit

E04D0293-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dipeptidase 1(DPEP1) ELISA kit

E04D0293-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dipeptidase 1(DPEP1) ELISA kit

E09D0293-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dipeptidase 1(DPEP1) ELISA kit

E09D0293-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Dipeptidase 1(DPEP1) ELISA kit

E09D0293-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dipeptidase 1(DPEP1) ELISA kit

E08D0293-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dipeptidase 1(DPEP1) ELISA kit

E08D0293-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Dipeptidase 1(DPEP1) ELISA kit

E08D0293-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dipeptidase 1(DPEP1) ELISA kit

E07D0293-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dipeptidase 1(DPEP1) ELISA kit

E07D0293-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Dipeptidase 1(DPEP1) ELISA kit

E07D0293-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Dipeptidase 1, DPEP1 ELISA KIT

ELI-09394p 96 Tests
EUR 928

Rabbit Dipeptidase 1, DPEP1 ELISA KIT

ELI-31738Ra 96 Tests
EUR 928

Mouse Dipeptidase 3, Dpep3 ELISA KIT

ELI-32831m 96 Tests
EUR 865

Mouse Dipeptidase 1, Dpep1 ELISA KIT

ELI-46905m 96 Tests
EUR 865

Bovine Dipeptidase 1, DPEP1 ELISA KIT

ELI-47085b 96 Tests
EUR 928

Human NAALAD2(N-acetylated-alpha-linked acidic dipeptidase 2) ELISA Kit

EH14948 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human N-acetylated-alpha-linked acidic dipeptidase 2 (NAALAD2) ELISA Kit

abx385188-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

CNDP2 CNDP Dipeptidase 2 Human Recombinant Protein

PROTQ96KP4 Regular: 20ug
EUR 317
Description: CNDP2 Human Recombinant produced in E. coli is a single polypeptide chain containing 498 amino acids (1-475) and having a molecular mass of 55.3 kDa. CNDP2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

DPEP2 ORF Vector (Human) (pORF)

ORF003245 1.0 ug DNA
EUR 95

Dpep1 ELISA Kit| Rat Dipeptidase 1 ELISA Kit

EF018586 96 Tests
EUR 689

Dpep1 ELISA Kit| Mouse Dipeptidase 1 ELISA Kit

EF014700 96 Tests
EUR 689

DPEP1 ELISA Kit| Bovine Dipeptidase 1 ELISA Kit

EF011322 96 Tests
EUR 689

Human β Ala His dipeptidase(CNDP1) ELISA kit

E01B0887-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β Ala His dipeptidase(CNDP1) ELISA kit

E01B0887-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β Ala His dipeptidase(CNDP1) ELISA kit

E01B0887-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β Ala His dipeptidase(CNDP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CNDP2/ Cytosolic non-specific dipeptidase ELISA Kit

E0512Hu 1 Kit
EUR 571

Human Cytosolic non specific dipeptidase(CNDP2) ELISA kit

E01C1842-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytosolic non specific dipeptidase(CNDP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytosolic non specific dipeptidase(CNDP2) ELISA kit

E01C1842-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytosolic non specific dipeptidase(CNDP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytosolic non specific dipeptidase(CNDP2) ELISA kit

E01C1842-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cytosolic non specific dipeptidase(CNDP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytosolic Non-Specific Dipeptidase (CNDP2) ELISA Kit

abx250625-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Beta-Ala-His Dipeptidase (CNDP1) ELISA Kit

abx250626-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Cytosolic non-specific dipeptidase

EK2911 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cytosolic non-specific dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Beta-Ala-His dipeptidase

EK2912 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Beta-Ala-His dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CNDP1/ Beta-Ala-His dipeptidase ELISA Kit

E2761Hu 1 Kit
EUR 571

Human CNDP2(Cytosolic non-specific dipeptidase) ELISA Kit

EH1355 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: Q96KP4
  • Alias: CNDP2(Cytosolic non-specific dipeptidase)/CN2/CPGL/PEPA/CNDP dipeptidase 2/CNDP dipeptidase 2(metallopeptidase M20 family)/cytosolic nonspecific dipeptidase/Peptidase AGlutamate carboxypeptidas
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human CNDP1(Beta-Ala-His dipeptidase) ELISA Kit

EH1356 96T
EUR 567.6
  • Detection range: 1.56-100 ng/ml
  • Uniprot ID: Q96KN2
  • Alias: CNDP1(Carnosine Dipeptidase 1)/CPGL2/CN1/Carnosinase 1/beta-Ala-His dipeptidase/carnosine dipeptidase 1(metallopeptidase M20 family)/CNDP dipeptidase 1/Glutamate carboxypeptidase-like protein
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Cytosolic non- specific dipeptidase, CNDP2 ELISA KIT

ELI-03926h 96 Tests
EUR 824

Human Beta- Ala- His dipeptidase, CNDP1 ELISA KIT

ELI-03930h 96 Tests
EUR 824

ELISA kit for Human CNDP1 (Carnosine Dipeptidase 1)

ELK3128 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carnosine Dipeptidase 1 (CNDP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ca
  • Show more
Description: A sandwich ELISA kit for detection of Carnosine Dipeptidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human DPEP1 (Dipeptidase 1, Renal)

ELK4773 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dipeptidase 1, Renal (DPEP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dipep
  • Show more
Description: A sandwich ELISA kit for detection of Dipeptidase 1, Renal from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit

CSB-E16196h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Xaa-Pro Dipeptidase/Prolidase(PEPD) ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xaa-Pro Dipeptidase/Prolidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Beta-Ala-His dipeptidase(CNDP1) ELISA kit

CSB-EL005639HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Beta-Ala-His dipeptidase (CNDP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Beta-Ala-His dipeptidase(CNDP1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Beta-Ala-His dipeptidase(CNDP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Dipeptidase 3 (DPEP3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Dpep2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6523103 1.0 ug DNA
EUR 154

Dpep2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3692403 1.0 ug DNA
EUR 154

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit

CSB-EL017784MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase (PEPD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Xaa-Pro dipeptidase(PEPD) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Xaa-Pro dipeptidase(PEPD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Guinea pig Dipeptidase 1(DPEP1) ELISA kit

E05D0293-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dipeptidase 1(DPEP1) ELISA kit

E05D0293-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Dipeptidase 1(DPEP1) ELISA kit

E05D0293-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Dipeptidase 1(DPEP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Xaa-Pro dipeptidase (PEPD) ELISA Kit

abx256674-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Rat Xaa-Pro dipeptidase

EK4922 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Xaa-Pro dipeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Pepd/ Xaa-Pro dipeptidase ELISA Kit

E0748Ra 1 Kit
EUR 646

Rat Xaa- Pro dipeptidase, Pepd ELISA KIT

ELI-07705r 96 Tests
EUR 886

Mouse Xaa- Pro dipeptidase, Pepd ELISA KIT

ELI-07706m 96 Tests
EUR 865

Mouse Xaa-Pro dipeptidase (PEPD) ELISA Kit

abx521027-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Cow Dipeptidase 1, Renal (DPEP1) ELISA Kit

abx521270-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dipeptidase 1, Renal (DPEP1) ELISA Kit

abx521272-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Dipeptidase 1, Renal (DPEP1) ELISA Kit

abx521273-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Dipeptidase 1, Renal (DPEP1) ELISA Kit

abx521274-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Pepd(Xaa-Pro dipeptidase) ELISA Kit

ER0699 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q5I0D7
  • Alias: Pepd/Proline dipeptidase(Prolidase)/Imidodipeptidase/Peptidase D/PRD
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

Pepd ELISA Kit| Rat Xaa-Pro dipeptidase ELISA Kit

EF017512 96 Tests
EUR 689

Pepd ELISA Kit| Mouse Xaa-Pro dipeptidase ELISA Kit

EF015818 96 Tests
EUR 689

Rat DPEP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPEP2 Polyclonal Conjugated Antibody

C29311 100ul
EUR 397

Mouse DPEP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPEP2 Recombinant Protein (Rat)

RP198554 100 ug Ask for price

Human DPEP2(Dipeptidase 2) ELISA Kit