Human AFMID(Arylformamidase) ELISA Kit

Human AFMID(Arylformamidase) ELISA Kit

To Order: Contact us

Human Arylformamidase (AFMID) ELISA Kit

RDR-AFMID-Hu-48Tests 48 Tests
EUR 544

Human Arylformamidase (AFMID) ELISA Kit

RDR-AFMID-Hu-96Tests 96 Tests
EUR 756

Human Arylformamidase (AFMID) ELISA Kit

20-abx150744
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Arylformamidase(AFMID)ELISA Kit

QY-E03639 96T
EUR 361

Human Arylformamidase (AFMID) ELISA Kit

SEJ665Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Arylformamidase (AFMID) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Arylformamidase (AFMID) in Tissue homogenates, cell lysates and other biological fluids.

Human Arylformamidase (AFMID) ELISA Kit

SEJ665Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Arylformamidase (AFMID) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Arylformamidase (AFMID) in Tissue homogenates, cell lysates and other biological fluids.

Human Arylformamidase (AFMID) ELISA Kit

SEJ665Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Arylformamidase (AFMID) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Arylformamidase (AFMID) in Tissue homogenates, cell lysates and other biological fluids.

Human Arylformamidase (AFMID) ELISA Kit

SEJ665Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Arylformamidase (AFMID) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Arylformamidase (AFMID) in Tissue homogenates, cell lysates and other biological fluids.

Human Arylformamidase (AFMID) ELISA Kit

4-SEJ665Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Arylformamidase elisa. Alternative names of the recognized antigen: KF
  • KFA
  • FKF
  • Kynurenine formamidase
  • N-formylkynurenine formamidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Arylformamidase (AFMID) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Arylformamidase (AFMID) Antibody

20-abx175476
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Arylformamidase (AFMID) Antibody

20-abx171327
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Arylformamidase (AFMID) Antibody

abx230202-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human Arylformamidase (AFMID) Protein

20-abx652587
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Arylformamidase (AFMID) CLIA Kit

20-abx495758
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human AFMID (Arylformamidase)

ELK4511 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Arylformamidase (AFMID). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Arylformam
  • Show more
Description: A sandwich ELISA kit for detection of Arylformamidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Probable arylformamidase, AFMID ELISA KIT

ELI-49540h 96 Tests
EUR 824

Mouse Probable arylformamidase, Afmid ELISA KIT

ELI-49541m 96 Tests
EUR 865

ELISA kit for Human Probable arylformamidase (AFMID)

KTE60956-48T 48T
EUR 332
  • Arylformamidase (AFMID) is the second enzyme of the kynurenine pathway metabolizing tryptophan to nicotinic acid and nicotinamide adenine dinucleotide cofactors. Inhibition of AFMID by organophosphorus insecticides in developing chicken embryos is co
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Probable arylformamidase (AFMID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Probable arylformamidase (AFMID)

KTE60956-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Arylformamidase (AFMID) is the second enzyme of the kynurenine pathway metabolizing tryptophan to nicotinic acid and nicotinamide adenine dinucleotide cofactors. Inhibition of AFMID by organophosphorus insecticides in developing chicken embryos is co
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Probable arylformamidase (AFMID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Probable arylformamidase (AFMID)

KTE60956-96T 96T
EUR 539
  • Arylformamidase (AFMID) is the second enzyme of the kynurenine pathway metabolizing tryptophan to nicotinic acid and nicotinamide adenine dinucleotide cofactors. Inhibition of AFMID by organophosphorus insecticides in developing chicken embryos is co
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Probable arylformamidase (AFMID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

AFMID ELISA KIT|Human

EF007651 96 Tests
EUR 689

AFMID ELISA Kit (Human) (OKCD02010)

OKCD02010 96 Wells
EUR 831
Description: Description of target: Catalyzes the hydrolysis of N-formyl-L-kynurenine to L-kynurenine, the second step in the kynurenine pathway of tryptophan degradation. Kynurenine may be further oxidized to nicotinic acid, NAD(H) and NADP(H). Required for elimination of toxic metabolites.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.57 ng/mL

AFMID Antibody

DF12814 200ul
EUR 304
Description: AFMID Antibody detects endogenous levels of AFMID.

AFMID siRNA

20-abx906957
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AFMID siRNA

20-abx906958
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human AFMID shRNA Plasmid

20-abx964802
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AFMID Recombinant Protein (Human)

RP036508 100 ug Ask for price

AFMID Polyclonal Antibody

28578-100ul 100ul
EUR 252

AFMID Polyclonal Antibody

28578-50ul 50ul
EUR 187

AFMID Rabbit pAb

A14441-100ul 100 ul
EUR 308

AFMID Rabbit pAb

A14441-200ul 200 ul
EUR 459

AFMID Rabbit pAb

A14441-20ul 20 ul
EUR 183

AFMID Rabbit pAb

A14441-50ul 50 ul
EUR 223

AFMID Blocking Peptide

DF12814-BP 1mg
EUR 195

AFMID cloning plasmid

CSB-CL714394HU-10ug 10ug
EUR 364
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 912
  • Sequence: atgatggatgtgtctggtgtgggtttcccaagcaaggttccttggaagaagatgtctgcagaggagctggagaatcagtactgtcccagccgatgggttgtccgactgggagcagaggaagccttgaggacctactcacagataggaattgaagccaccacaagggcccgggccac
  • Show more
Description: A cloning plasmid for the AFMID gene.

anti- AFMID antibody

FNab00202 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: arylformamidase
  • Uniprot ID: Q63HM1
  • Gene ID: 125061
  • Research Area: Metabolism
Description: Antibody raised against AFMID

Anti-AFMID antibody

PAab00202 100 ug
EUR 355

Anti-AFMID antibody

STJ116651 100 µl
EUR 277

AFMID ORF Vector (Human) (pORF)

ORF012170 1.0 ug DNA
EUR 354

Mouse AFMID shRNA Plasmid

20-abx977430
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AFMID Polyclonal Conjugated Antibody

C28578 100ul
EUR 397

AFMID Recombinant Protein (Mouse)

RP114710 100 ug Ask for price

AFMID Recombinant Protein (Rat)

RP189482 100 ug Ask for price

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

AFMID sgRNA CRISPR Lentivector set (Human)

K0055601 3 x 1.0 ug
EUR 339

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Afmid ORF Vector (Rat) (pORF)

ORF063162 1.0 ug DNA
EUR 506

Afmid ORF Vector (Mouse) (pORF)

ORF038238 1.0 ug DNA
EUR 506

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

AFMID sgRNA CRISPR Lentivector (Human) (Target 1)

K0055602 1.0 ug DNA
EUR 154

AFMID sgRNA CRISPR Lentivector (Human) (Target 2)

K0055603 1.0 ug DNA
EUR 154

AFMID sgRNA CRISPR Lentivector (Human) (Target 3)

K0055604 1.0 ug DNA
EUR 154

AFMID Protein Vector (Human) (pPB-His-MBP)

PV320358 500 ng
EUR 481

AFMID Protein Vector (Human) (pPB-His-GST)

PV320359 500 ng
EUR 481

AFMID Protein Vector (Human) (pPB-C-His)

PV048677 500 ng
EUR 481

AFMID Protein Vector (Human) (pPB-N-His)

PV048678 500 ng
EUR 481

AFMID Protein Vector (Human) (pPM-C-HA)

PV048679 500 ng
EUR 481

AFMID Protein Vector (Human) (pPM-C-His)

PV048680 500 ng
EUR 481

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AFMID Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV706557 1.0 ug DNA
EUR 450

AFMID Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV706561 1.0 ug DNA
EUR 450

AFMID Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV706562 1.0 ug DNA
EUR 450

Afmid sgRNA CRISPR Lentivector set (Rat)

K6061601 3 x 1.0 ug
EUR 339

Afmid sgRNA CRISPR Lentivector set (Mouse)

K4725101 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AFMID Protein Vector (Human) (pPM-N-D-C-HA)

PV320360 500 ng
EUR 552

AFMID Protein Vector (Human) (pPM-N-D-C-His)

PV320361 500 ng
EUR 552

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Afmid sgRNA CRISPR Lentivector (Rat) (Target 1)

K6061602 1.0 ug DNA
EUR 154

Afmid sgRNA CRISPR Lentivector (Rat) (Target 2)

K6061603 1.0 ug DNA
EUR 154

Afmid sgRNA CRISPR Lentivector (Rat) (Target 3)

K6061604 1.0 ug DNA
EUR 154

Afmid sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4725102 1.0 ug DNA
EUR 154

Afmid sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4725103 1.0 ug DNA
EUR 154

Afmid sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4725104 1.0 ug DNA
EUR 154

AFMID Protein Vector (Mouse) (pPB-C-His)

PV152950 500 ng
EUR 603

AFMID Protein Vector (Mouse) (pPB-N-His)

PV152951 500 ng
EUR 603

AFMID Protein Vector (Mouse) (pPM-C-HA)

PV152952 500 ng
EUR 603

AFMID Protein Vector (Mouse) (pPM-C-His)

PV152953 500 ng
EUR 603

AFMID Protein Vector (Rat) (pPB-C-His)

PV252646 500 ng
EUR 603

AFMID Protein Vector (Rat) (pPB-N-His)

PV252647 500 ng
EUR 603

AFMID Protein Vector (Rat) (pPM-C-HA)

PV252648 500 ng
EUR 603

AFMID Protein Vector (Rat) (pPM-C-His)

PV252649 500 ng
EUR 603

Afmid 3'UTR Luciferase Stable Cell Line

TU101497 1.0 ml Ask for price

Afmid 3'UTR GFP Stable Cell Line

TU151497 1.0 ml Ask for price

Afmid 3'UTR Luciferase Stable Cell Line

TU200373 1.0 ml Ask for price

Afmid 3'UTR GFP Stable Cell Line

TU250373 1.0 ml Ask for price

AFMID 3'UTR GFP Stable Cell Line

TU050438 1.0 ml
EUR 1521

AFMID 3'UTR Luciferase Stable Cell Line

TU000438 1.0 ml
EUR 1521

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

AFMID sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0055605 3 x 1.0 ug
EUR 376

AFMID Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV706558 1.0 ug DNA
EUR 450

AFMID Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV706559 1.0 ug DNA
EUR 508

AFMID Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV706560 1.0 ug DNA
EUR 508

Human AFMID(Arylformamidase) ELISA Kit