Human AFMID(Arylformamidase) ELISA Kit

To Order: Contact us

Human Arylformamidase (AFMID) ELISA Kit
RDR-AFMID-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Arylformamidase (AFMID) ELISA Kit
RDR-AFMID-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Arylformamidase (AFMID) ELISA Kit
20-abx150744	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Arylformamidase(AFMID)ELISA Kit
QY-E03639	Qayee Biotechnology	96T	EUR 361

Human Arylformamidase (AFMID) ELISA Kit
SEJ665Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Arylformamidase (AFMID) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Arylformamidase (AFMID) in Tissue homogenates, cell lysates and other biological fluids.

Human Arylformamidase (AFMID) ELISA Kit
SEJ665Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Arylformamidase (AFMID) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Arylformamidase (AFMID) in Tissue homogenates, cell lysates and other biological fluids.

Human Arylformamidase (AFMID) ELISA Kit
SEJ665Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Arylformamidase (AFMID) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Arylformamidase (AFMID) in Tissue homogenates, cell lysates and other biological fluids.

Human Arylformamidase (AFMID) ELISA Kit
SEJ665Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Arylformamidase (AFMID) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Arylformamidase (AFMID) in Tissue homogenates, cell lysates and other biological fluids.

Human Arylformamidase (AFMID) ELISA Kit
4-SEJ665Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Arylformamidase elisa. Alternative names of the recognized antigen: KF KFA FKF Kynurenine formamidase N-formylkynurenine formamidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Arylformamidase (AFMID) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Arylformamidase (AFMID) Antibody
20-abx175476	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Arylformamidase (AFMID) Antibody
abx230202-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Arylformamidase (AFMID) Antibody
20-abx171327	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Human Arylformamidase (AFMID) Protein
20-abx652587	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Arylformamidase (AFMID) CLIA Kit
20-abx495758	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human AFMID (Arylformamidase)
ELK4511	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Arylformamidase (AFMID). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Arylformam Show more
Description: A sandwich ELISA kit for detection of Arylformamidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Probable arylformamidase, AFMID ELISA KIT
ELI-49540h	Lifescience Market	96 Tests	EUR 824

Mouse Probable arylformamidase, Afmid ELISA KIT
ELI-49541m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human Probable arylformamidase (AFMID)
KTE60956-48T	Abbkine	48T	EUR 332
Arylformamidase (AFMID) is the second enzyme of the kynurenine pathway metabolizing tryptophan to nicotinic acid and nicotinamide adenine dinucleotide cofactors. Inhibition of AFMID by organophosphorus insecticides in developing chicken embryos is co Show more
Description: Quantitative sandwich ELISA for measuring Human Probable arylformamidase (AFMID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Probable arylformamidase (AFMID)
KTE60956-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Arylformamidase (AFMID) is the second enzyme of the kynurenine pathway metabolizing tryptophan to nicotinic acid and nicotinamide adenine dinucleotide cofactors. Inhibition of AFMID by organophosphorus insecticides in developing chicken embryos is co Show more
Description: Quantitative sandwich ELISA for measuring Human Probable arylformamidase (AFMID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Probable arylformamidase (AFMID)
KTE60956-96T	Abbkine	96T	EUR 539
Arylformamidase (AFMID) is the second enzyme of the kynurenine pathway metabolizing tryptophan to nicotinic acid and nicotinamide adenine dinucleotide cofactors. Inhibition of AFMID by organophosphorus insecticides in developing chicken embryos is co Show more
Description: Quantitative sandwich ELISA for measuring Human Probable arylformamidase (AFMID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

AFMID ELISA KIT|Human
EF007651	Lifescience Market	96 Tests	EUR 689

AFMID ELISA Kit (Human) (OKCD02010)
OKCD02010	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Catalyzes the hydrolysis of N-formyl-L-kynurenine to L-kynurenine, the second step in the kynurenine pathway of tryptophan degradation. Kynurenine may be further oxidized to nicotinic acid, NAD(H) and NADP(H). Required for elimination of toxic metabolites.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.57 ng/mL

AFMID siRNA
20-abx906957	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AFMID siRNA
20-abx906958	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AFMID Antibody
DF12814	Affbiotech	200ul	EUR 304
Description: AFMID Antibody detects endogenous levels of AFMID.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human AFMID shRNA Plasmid
20-abx964802	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

AFMID Recombinant Protein (Human)
RP036508	ABM	100 ug	Ask for price

anti- AFMID antibody
FNab00202	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:2000 IHC: 1:20-1:200 Immunogen: arylformamidase Uniprot ID: Q63HM1 Gene ID: 125061 Research Area: Metabolism
Description: Antibody raised against AFMID

AFMID Rabbit pAb
A14441-100ul	Abclonal	100 ul	EUR 308

AFMID Rabbit pAb
A14441-200ul	Abclonal	200 ul	EUR 459

AFMID Rabbit pAb
A14441-20ul	Abclonal	20 ul	EUR 183

AFMID Rabbit pAb
A14441-50ul	Abclonal	50 ul	EUR 223

AFMID Polyclonal Antibody
28578-100ul	SAB	100ul	EUR 252

AFMID Polyclonal Antibody
28578-50ul	SAB	50ul	EUR 187

AFMID Blocking Peptide
DF12814-BP	Affbiotech	1mg	EUR 195

AFMID cloning plasmid
CSB-CL714394HU-10ug	Cusabio	10ug	EUR 364
Formulation: 10 μg plasmid + 200μl Glycerol Length: 912 Sequence: atgatggatgtgtctggtgtgggtttcccaagcaaggttccttggaagaagatgtctgcagaggagctggagaatcagtactgtcccagccgatgggttgtccgactgggagcagaggaagccttgaggacctactcacagataggaattgaagccaccacaagggcccgggccac Show more
Description: A cloning plasmid for the AFMID gene.

Anti-AFMID antibody
PAab00202	Lifescience Market	100 ug	EUR 355

Anti-AFMID antibody
STJ116651	St John's Laboratory	100 µl	EUR 277

AFMID ORF Vector (Human) (pORF)
ORF012170	ABM	1.0 ug DNA	EUR 354

AFMID Polyclonal Conjugated Antibody
C28578	SAB	100ul	EUR 397

Mouse AFMID shRNA Plasmid
20-abx977430	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

AFMID Recombinant Protein (Rat)
RP189482	ABM	100 ug	Ask for price

AFMID Recombinant Protein (Mouse)
RP114710	ABM	100 ug	Ask for price

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

AFMID sgRNA CRISPR Lentivector set (Human)
K0055601	ABM	3 x 1.0 ug	EUR 339

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Afmid ORF Vector (Mouse) (pORF)
ORF038238	ABM	1.0 ug DNA	EUR 506

Afmid ORF Vector (Rat) (pORF)
ORF063162	ABM	1.0 ug DNA	EUR 506

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

AFMID sgRNA CRISPR Lentivector (Human) (Target 1)
K0055602	ABM	1.0 ug DNA	EUR 154

AFMID sgRNA CRISPR Lentivector (Human) (Target 2)
K0055603	ABM	1.0 ug DNA	EUR 154

AFMID sgRNA CRISPR Lentivector (Human) (Target 3)
K0055604	ABM	1.0 ug DNA	EUR 154

AFMID Protein Vector (Human) (pPB-C-His)
PV048677	ABM	500 ng	EUR 481

AFMID Protein Vector (Human) (pPB-N-His)
PV048678	ABM	500 ng	EUR 481

AFMID Protein Vector (Human) (pPM-C-HA)
PV048679	ABM	500 ng	EUR 481

AFMID Protein Vector (Human) (pPM-C-His)
PV048680	ABM	500 ng	EUR 481

AFMID Protein Vector (Human) (pPB-His-MBP)
PV320358	ABM	500 ng	EUR 481

AFMID Protein Vector (Human) (pPB-His-GST)
PV320359	ABM	500 ng	EUR 481

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

AFMID Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV706557	ABM	1.0 ug DNA	EUR 450

AFMID Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV706561	ABM	1.0 ug DNA	EUR 450

AFMID Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV706562	ABM	1.0 ug DNA	EUR 450

Afmid sgRNA CRISPR Lentivector set (Mouse)
K4725101	ABM	3 x 1.0 ug	EUR 339

Afmid sgRNA CRISPR Lentivector set (Rat)
K6061601	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AFMID Protein Vector (Human) (pPM-N-D-C-HA)
PV320360	ABM	500 ng	EUR 552

AFMID Protein Vector (Human) (pPM-N-D-C-His)
PV320361	ABM	500 ng	EUR 552

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Afmid sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4725102	ABM	1.0 ug DNA	EUR 154

Afmid sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4725103	ABM	1.0 ug DNA	EUR 154

Afmid sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4725104	ABM	1.0 ug DNA	EUR 154

Afmid sgRNA CRISPR Lentivector (Rat) (Target 1)
K6061602	ABM	1.0 ug DNA	EUR 154

Afmid sgRNA CRISPR Lentivector (Rat) (Target 2)
K6061603	ABM	1.0 ug DNA	EUR 154

Afmid sgRNA CRISPR Lentivector (Rat) (Target 3)
K6061604	ABM	1.0 ug DNA	EUR 154

AFMID Protein Vector (Mouse) (pPB-C-His)
PV152950	ABM	500 ng	EUR 603

AFMID Protein Vector (Mouse) (pPB-N-His)
PV152951	ABM	500 ng	EUR 603

AFMID Protein Vector (Mouse) (pPM-C-HA)
PV152952	ABM	500 ng	EUR 603

AFMID Protein Vector (Mouse) (pPM-C-His)
PV152953	ABM	500 ng	EUR 603

AFMID Protein Vector (Rat) (pPB-C-His)
PV252646	ABM	500 ng	EUR 603

AFMID Protein Vector (Rat) (pPB-N-His)
PV252647	ABM	500 ng	EUR 603

AFMID Protein Vector (Rat) (pPM-C-HA)
PV252648	ABM	500 ng	EUR 603

AFMID Protein Vector (Rat) (pPM-C-His)
PV252649	ABM	500 ng	EUR 603

Afmid 3'UTR Luciferase Stable Cell Line
TU200373	ABM	1.0 ml	Ask for price

Afmid 3'UTR GFP Stable Cell Line
TU151497	ABM	1.0 ml	Ask for price

AFMID 3'UTR Luciferase Stable Cell Line
TU000438	ABM	1.0 ml	EUR 1521

Afmid 3'UTR Luciferase Stable Cell Line
TU101497	ABM	1.0 ml	Ask for price

AFMID 3'UTR GFP Stable Cell Line
TU050438	ABM	1.0 ml	EUR 1521

Afmid 3'UTR GFP Stable Cell Line
TU250373	ABM	1.0 ml	Ask for price

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

AFMID sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0055605	ABM	3 x 1.0 ug	EUR 376

AFMID sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0055606	ABM	1.0 ug DNA	EUR 167

AFMID sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0055607	ABM	1.0 ug DNA	EUR 167

AFMID sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0055608	ABM	1.0 ug DNA	EUR 167

Human AFMID(Arylformamidase) ELISA Kit